Birdingonthe.NetRecent Postings from
> Home > Mail |
Forbes Plover,©BirdQuest |
|
8 Feb RFI: New Orleans [Donald Lewis ] 8 Feb Re: What the plumes on auklets may really be for [Dr Ronald Orenstein ] 8 Feb Re: What the plumes on auklets may really be for ["Spector, David (Biology)" ] 8 Feb Re: What the plumes on auklets may really be for [John Walters ] 8 Feb Re: What the plumes on auklets may really be for ["Barry K. MacKay" ] 8 Feb Re: What the plumes on auklets may really be for [Rick ] 8 Feb Re: What the plumes on auklets may really be for [Laura Erickson ] 8 Feb Accommodations at Khao Yai in Thailand [mebalestri ] 8 Feb Re: What the plumes on auklets may really be for [Ronald Orenstein ] 8 Feb Re: What the plumes on auklets may really be for [Rick ] 8 Feb What the plumes on auklets may really be for [Ronald Orenstein ] 7 Feb Re: Eagles Poisoned by Lead [Rick ] 7 Feb Re: Eagles Poisoned by Lead [Ken Sayers ] 7 Feb Eagles Poisoned by Lead [Ed Stonick ] 7 Feb rfi quail chick id [Ronald Cicerello ] 7 Feb Finally snow in Tromsø, N.Norway [Vader Willem Jan Marinus ] 6 Feb Re: Amazing things in birding [Jules Levin ] 6 Feb Re: Amazing things in birding [Jerry Blinn ] 6 Feb Puerto Rico Trip Report [Patrick Belardo ] 6 Feb Horned Guan [Rick Wright ] 6 Feb rfi Horned Guan Guatemala [Ronald Cicerello ] 6 Feb BirdNote, last week, and the week of February 7, 2010 [Ellen Blackstone ] 1 Jan Re: Amazing things in birding [Gail Mackiernan ] 6 Feb Amazing things in birding [Bird Uganda Safaris ] 2 Feb RFI: South Florida guides [Joe Byrnes ] 2 Feb RFI: South Florida guides [Mark Adams ] 2 Feb Life lists [Dinah Pulver ] 1 Feb evolution of birds and bird-like dinos; interpreting fossils; free NATURE on your iPhone (links) [Devorah Bennu ] 31 Jan Mexican Duck re-split from Mallard ["David J. Ringer" ] 31 Jan RFI:Birding Brazil ["Levine, Barron S" ] 31 Jan RFI:Birding Brazil ["Levine, Barron S" ] 31 Jan Oceanside (San Diego) Pelagic Trip Report 30JAN2010 [Terry Hunefeld ] 30 Jan Dominican Republic Birding [Tom Arny ] 30 Jan BirdNote, last week, and the week of January 31, 2010 [Ellen Blackstone ] 30 Jan "Cotingas" by David Snow ["David M. Gascoigne" ] 30 Jan URGENT CFP & Expressions of Interest - SoE meeting, Victoria BC, 5-8 May 2010 [bob gosford ] 29 Jan stunning mystery birds BIRD video, orange stripey dinosaurs? (links) [Devorah Bennu ] 29 Jan BIRDERS! LOOKING FOR QUICK PASSAGE TO INDIA? [Kamla Nambiar ] 29 Jan Lesser Paradise Kingfisher at Saibai Island - Northern Myth blog & Crikey posts [bob gosford ] 28 Jan RFI: Dominican Republic [savagebirder ] 28 Jan dinosaur feather color and evolution of plumage, mystery bird (links) [Devorah Bennu ] 28 Jan Re: starving brown pelicans ["Jamie S." ] 28 Jan Re: starving brown pelicans [Kitty Jones ] 28 Jan starving brown pelicans [Devorah Bennu ] 27 Jan Loudest, most voluminous wood warbler song [William Saur ] 26 Jan Alaska Tips [KAREN FORCUM ] 26 Jan Ivory Gull in Georgia [Brandon Best ] 26 Jan Re: Loudest/Most Voluminous Wood-Warbler Call Note? Speculating Only...... [Eric Lundquist ] 26 Jan Re: Loudest/Most Voluminous Wood-Warbler Call Note? Speculating On... [Mary Beth Stowe ] 25 Jan Caracaras [Katharine Mills ] 25 Jan Hilton Pond 01/16/10 (Feeder Birds) ["Bill Hilton Jr. (RESEARCH)" ] 25 Jan mystery bird challenge, red bird feathers, & evolution of long-distance migration (links) [Devorah Bennu ] 25 Jan Avoid unscrupulous people [Bird Uganda Safaris ] 25 Jan Fwd: Rejected posting to BIRDCHAT@LISTSERV.ARIZONA.EDU [The RIDERS ] 24 Jan Ecuador Pictures ["David M. Gascoigne" ] 24 Jan Woodpecker experts haven't seen supposed Ivory-bill photos ["gljeinwv AT juno.com" ] 24 Jan VS: Tromsø, at 70*N [Vader Willem Jan Marinus ] 23 Jan Sax-Zim Bog Bird Festival - Last week [Michael Hendrickson ] 23 Jan Woodpecker experts haven't seen supposed Ivory-bill photos [Tim Boucher ] 23 Jan BirdNote, last week, and the week of January 24, 2010 [Ellen Blackstone ] 22 Jan Loudest/Most Voluminous Wood-Warbler Call Note? Speculating Only...... [Daniel Edelstein ] 22 Jan Texas Whooping Cranes (21 January 2010) census update [Patty Waits Beasley ] 22 Jan vortex binos [Michael Wiegand ] 22 Jan Woodpecker experts haven't seen supposed Ivory-bill photos [Matt Mendenhall ] 22 Jan About that photo in Birding magazine... [Ted Floyd ] 21 Jan Re: Audubon: The Flicker Years ["snorkler AT juno.com" ] 21 Jan Audubon: The Flicker Years [Rob Fergus ] 20 Jan Flicker resigns, top ornithologist and birder Frank Gill to head up Audubon for now [Rob Fergus ] 20 Jan Trip report Ecuador December 18, 2009 - January 4, 2010 ["David M. Gascoigne" ] 20 Jan [Fwd: Help Shape the Future of Po int Pelee / Aidez-nous à définir l?aven ir de la Pointe-Pelée] [bruce ] 20 Jan Ted Eubanks commentary in January 2010 Birding [Ted Floyd ] 20 Jan Advice on Paup [John Penhallurick ] 19 Jan Re: Trip Report: Chiapas [Alaxsxaq ] 19 Jan Trip Report: Chiapas [Janet Duerr ] 18 Jan Clements 2009 taxonomy update available [Jerry Blinn ] 18 Jan British Columbia: Oriental Turtle-Dove [Rick Wright ] Subject: RFI: New Orleans From: Donald Lewis <donlewis AT COMCAST.NET> Date: Mon, 8 Feb 2010 15:42:55 -0800 I will be in New Orleans in mid-April and have one day to go birding, Thursday, April 15. I will rent a car and would like to see as many eastern birds as possible, including especially migrating warblers. There is lots of information on the web, including various birding trails with zillions of places to bird. But which one or two or three places will give me the most fun and birds? Is Jean Lafitte National Historic Park one of them? Any and all tips will be much appreciated. Thanks, Don Lewis Lafayette, CA donlewis AT comcast.net BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Re: What the plumes on auklets may really be for From: Dr Ronald Orenstein <ron.orenstein AT ROGERS.COM> Date: Mon, 8 Feb 2010 14:32:46 -0800 Once again - the point of this paper is not that birds use feathers for tactile purposes. We knew that already. It is that the evolution of long ornamental plumes could have started with feathers that were originally tactile in function, but once they reached a certain size may have been selected for in addition for their ornamental value. That, as far as I know, is a new idea - a way for birds to become, in effect, the cat's whiskers. Sent from my iPhone On Feb 8, 2010, at 3:53 PM, Laura EricksonSubject: Re: What the plumes on auklets may really be for From: "Spector, David (Biology)" <spectord AT MAIL.CCSU.EDU> Date: Mon, 8 Feb 2010 17:27:28 -0500 "Christopher Columbus, as everyone knows, is honored by posterity because he was the last to discover America." attributed to James Joyce, but I don't know where in his writing David David Spector Belchertown, Massachusetts -----Original Message----- From: National Birding Hotline Cooperative (Chat Line) [mailto:BIRDCHAT AT LISTSERV.ARIZONA.EDU] On Behalf Of Barry K. MacKay Sent: Monday, February 08, 2010 5:24 PM To: BIRDCHAT AT LISTSERV.ARIZONA.EDU Subject: Re: [BIRDCHAT] What the plumes on auklets may really be for Ah, but where the Hopi and Pima Indians erred was in not publishing their findings in the peer-reviewed literature, although I think latitude should be given to the fact that such literature did not yet existSubject: Re: What the plumes on auklets may really be for From: John Walters <john-walters AT COX.NET> Date: Mon, 8 Feb 2010 14:26:08 -0800 Rick wrote: > Laura Erickson wrote: >>> That was basiscally my point. This research may be interesting and >>> useful for Wiskered Acuklets but, modified feathers for tactile use >>> is clearly not new ground. Frank Gill's 3ed of Ornithology has a >>> section on bristles. My reading of the abstract (haven't looked at the actual paper) is that the researchers are suggesting why elongated feathers first evolved. The bristles and other tactile feathers usually aren't any longer than the other contour feathers. Evolution often works on an existing structure and modifies it for another purpose; thus the researchers hypothesize that the auklet's plumes first evolved with a sensory function and only later acquired a role in sexual selection. John Walters Bonita, CA john-walters AT cox.net BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Re: What the plumes on auklets may really be for From: "Barry K. MacKay" <mimus AT SYMPATICO.CA> Date: Mon, 8 Feb 2010 17:23:59 -0500 Ah, but where the Hopi and Pima Indians erred was in not publishing their findings in the peer-reviewed literature, although I think latitude should be given to the fact that such literature did not yet existSubject: Re: What the plumes on auklets may really be for From: Rick <fholbrook AT CABLEONE.NET> Date: Mon, 8 Feb 2010 15:27:58 -0600 Laura Erickson wrote: >> That was basiscally my point. This research may be interesting and useful for Wiskered Acuklets but, modified feathers for tactile use is clearly not new ground. Frank Gill's 3ed of Ornithology has a section on bristles. >> -- Rick Fargo, ND N 46°53'251" W 096°48'279" Remember the USS Liberty http://www.ussliberty.org/ Reply to: fholbrookatcableone.net BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Re: What the plumes on auklets may really be for From: Laura Erickson <bluejay AT LAURAERICKSON.COM> Date: Mon, 8 Feb 2010 15:53:04 -0500 I'm not sure what the authors mean by "seldom-mentioned function," but my trusty old Welty "The Life of BIrds" from 1975 is pretty clear that there is likely a tactile function to many feathers, discussing the follicles surrounding rictal bristles and filoplumes being supplied with tactile nerve endings strongly suggesting a sensory function. This isn't to say that this particular study isn't valuable, verifying not only the tactile function but quantifying its value to the bird. But it always strikes me as amusing when people overstate the ignorance of the world before they made their amazing findings. My personal favorite example of this was when a big stir was made in the ornithological world when Jaeger "discovered" a hybernating Common Poorwill--the Hopi Indians refer to the poorwill as Hölchoko, “the sleeping one,” and the Pima Indians also knew about the bird's ability to use torpor long before this. Best, Laura Erickson Ithaca, NY when I'm not in Duluth, MN On Mon, Feb 8, 2010 at 2:21 PM, Ronald OrensteinSubject: Accommodations at Khao Yai in Thailand From: mebalestri <mebalestri AT COMCAST.NET> Date: Mon, 8 Feb 2010 15:20:03 -0500 We are headed to Khao Yai National Park in Thailand in a few weeks. Anyone out there have any recommendations for a nice, reasonably priced place to stay? -- Marcia Balestri Frederick, MD mebalestri AT comcast.net BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Re: What the plumes on auklets may really be for From: Ronald Orenstein <ron.orenstein AT ROGERS.COM> Date: Mon, 8 Feb 2010 11:21:53 -0800 The full paper, in Animal Behaviour, refers to the evolution of ornamental plumes only, not to all feathers. Here is the reference and abstract: Seneviratne, S. S. and I. L. Jones "Origin and maintenance of mechanosensory feather ornaments." Animal Behaviour In Press, Corrected Proof. Mechanosensory use is a seldom-mentioned function for feather ornaments, yet recent experimental evidence showed that the elaborate facial plumes of crevice-dwelling whiskered auklets, Aethia pygmaea, have just such a sensory role. Here we explored the evolutionary patterns of mechanosensory function of similar facial feather ornaments in related species. In an experimental chamber (maze) devoid of visible light, crested auklets, A. cristatella, a close relative of the whiskered auklet, showed an increase in head bumps (262%) after trial flattening of their forehead crest. The frequency of head bumps in the absence of the crest was positively correlated with the natural crest length of the crested auklet. There was no correlation between crest length and head bumps when we added an artificial crest to least auklets, A. pusilla, which do not have a natural crest. Thus, only the ornamented Aethia species that breed in deep-crevice appear to have detectable mechanosensory ability. A pairwise analysis across all nonpasserine bird families further revealed a greater frequency of elongated facial plumes in birds that live in complex habitats and are active during low light conditions. We suggest that selective pressure enforced by complex habitats may trigger facial feather exaggeration for mechanosensory use. Once the primordial sensory structures evolved, sexual and other social selection processes could act on these traits and lead towards further exaggeration. Ronald Orenstein 1825 Shady Creek Court Mississauga, ON L5L 3W2 Canada ----- Original Message ---- From: RickSubject: Re: What the plumes on auklets may really be for From: Rick <fholbrook AT CABLEONE.NET> Date: Mon, 8 Feb 2010 13:05:54 -0600 Ronald Orenstein wrote: I was under the impression that the fact birds used feathers or modified feathers for tactile functions--is that not what bristles are? (or is this specific for the Whiskered Aucklet?) -- Rick Fargo, ND N 46°53'251" W 096°48'279" Remember the USS Liberty http://www.ussliberty.org/ Reply to: fholbrookatcableone.net BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: What the plumes on auklets may really be for From: Ronald Orenstein <ron.orenstein AT ROGERS.COM> Date: Mon, 8 Feb 2010 09:58:24 -0800 Follow link for full article (including a very nice photo of Whiskered Auklet): http://news.bbc.co.uk/earth/hi/earth_news/newsid_8500000/8500620.stm Ronald Orenstein 1825 Shady Creek Court Mississauga, ON L5L 3W2 Canada BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Re: Eagles Poisoned by Lead From: Rick <fholbrook AT CABLEONE.NET> Date: Sun, 7 Feb 2010 12:48:47 -0600 Ed Stonick wrote: > Eagles Getting Sick On Food They Eat > > By Magdalene Landegent > Daily Sentinel > updated 8:03 a.m. PT, Sat., Feb. 6, 2010 >Subject: Re: Eagles Poisoned by Lead From: Ken Sayers <saybak AT COMCAST.NET> Date: Sun, 7 Feb 2010 11:20:10 -0500 I guess we can all be thankful they haven't started making shotgun slugs out of depleted uranium yet. k On Feb 7, 2010, at 9:32 AM, Ed Stonick wrote: > Eagles Getting Sick On Food They Eat > > By Magdalene Landegent > Daily Sentinel > updated 8:03 a.m. PT, Sat., Feb. 6, 2010 > > LE MARS, IOWA - > > Bald eagles are getting lead poisoning by eating deer carcasses that have > fragments of lead slugs in them. These carcasses are often those of deer > wounded by hunters but not retrieved. > Regards, > Ed > > Ed Stonick > Pasadena, CA > edstonick AT earthlink.net Ken Sayers Compass Lake, FL saybak AT comcast.net BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Eagles Poisoned by Lead From: Ed Stonick <edstonick AT EARTHLINK.NET> Date: Sun, 7 Feb 2010 06:32:40 -0800 Eagles Getting Sick On Food They Eat By Magdalene Landegent Daily Sentinel updated 8:03 a.m. PT, Sat., Feb. 6, 2010 LE MARS, IOWA - Bald eagles are being attacked by an emerging predator. It's in the food they eat. Eagle protection agencies have been seeing eagles that are oddly sick, explained Plymouth County Naturalist Victoria De Vos. "They started testing the blood and they are finding out that they had very high levels of lead — a neurotoxin," De Vos said. "It was basically paralyzing them in different ways." Bald eagles are getting lead poisoning by eating deer carcasses that have fragments of lead slugs in them. These carcasses are often those of deer wounded by hunters but not retrieved. "Eagles aren't very delicate eaters," said De Vos. "They don't pick through their food and see what they're eating." Lead poisoning is becoming more widespread, or at least more widely recognized, in Iowa's eagles. "Hunters have been harvesting more deer in Iowa, and most deer in Iowa are shot with a lead slug," said Kay Neumann, executive director at Saving Our Avian Resources (SOAR), an organization dedicated to eagle and other raptor rehabilitation along with research and education. SOAR is based in Dedham, Iowa. Neumann and others are urging hunters to replace lead ammunition with copper, which doesn't poison wildlife. When a lead slug enters a deer, parts of it shatter and spread out in the animal. Even the tiniest pieces are dangerous for eagles, because they are very susceptible to lead, Neumann said. "Two hundred milligrams is lethal to them. That's a baby aspirin size piece," she said. "They have such efficient digestive systems, it goes straight to their blood." Already this season, Neumann has treated four bald eagles with lead poisoning. "When they come in, they can't stand up, their stomach lining is ulcerated and they're puking green, some come in blind and they're usually gasping for air — the lead interferes with the oxygen in their blood, so they're starting to suffocate," Neumann said. "It's horrible." Lead mimics calcium, so eagles' bodies (and human bodies) readily absorb it and send it into the bones, blood and neurological system. "The eagles' brains swell, some have seizures," Neumann said. Last year in Iowa, 27 of 40 bald eagles treated at Iowa centers showed lead poisoning in their blood. Only a few had actually been shot. "When it's more than 60 percent, it's not random," Neumann said of eagles eating carcasses with lead. Pointing out that not all sick eagles are brought in for care, she estimated up to 176 eagles in Iowa could have been affected by lead poisoning in 2009 alone. "That's half of our breeding population," she said. Eagles aren't the only ones eating lead in their meat. Humans also unknowingly eat venison with lead fragments in it at times. Children are especially susceptible to lead poisoning because their bodies absorb calcium, and therefore lead, very quickly. In children, high levels of lead can do is lower their IQ, cause attention deficit disorder or worse, Neumann said. Lead has also been linked to diseases in adults like kidney failure, she added. There is a treatment available to both eagles and humans: chelation. "It's injections twice a day for the eagles," Neumann said. "It combines with the lead in the blood in a way that the kidneys can get rid of." Chelation is a four-week process of continually cleaning the blood. Even with treatment, the eagles may still die or never fully recover. "Most of these eagles come in with really high levels," Neumann said. "Most are not making it." Neumann, who said her whole family hunts deer, is calling on all hunters to use copper ammunition. "An eagle can eat an entire copper slug and be OK," she said. Copper ammunition, she admitted, is more expensive than lead. Copper solid shotgun slugs might cost $15 for a box of five, where lead slugs are around $9 or $10, she said. Dick Halter, owner of Shirts 'N Shooters in Le Mars, priced the difference for .22 long rifle cartridges and .270 caliber cartridges. For the .22 cartridges, lead core bullets were $2.99 for a 50 pack and the lead-free variety were $6.99 for a 50 pack. For the .270 caliber cartridges, the price is about the same. "That surprised me," Halter said. He noted that states are pushing more and more for non-lead ammunition. In Iowa, lead shot is illegal to use while hunting waterfowl. The idea is to prevent animals from eating the shot off the bottom of wetlands or from eating animals injured by the lead shot. California has strict regulations about lead bullets, he said. Neumann said the change isn't happening fast enough. She expects to see more lead-poisoned eagles in February with numbers peaking in March. "Northwest Iowa is a travel pathway for eagles," she said. "As they cut cross country away from the reservoirs heading north, they scavenge more." De Vos said the lead poisoning seen in eagles "is a shame." "To have bald eagles just off the endangered species list, and now this," De Vos said. "It's not good." Information from: Daily Sentinel, http://www.lemarssentinel.com Regards, Ed Ed Stonick Pasadena, CA edstonick AT earthlink.net BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: rfi quail chick id From: Ronald Cicerello <sungrebe AT EARTHLINK.NET> Date: Sun, 7 Feb 2010 06:50:02 -0500 This chick was photographed near the Rio Frio Station in Darien National Park. The hen slipped away and was not seen well. I would appreciate help in identifying the chick pictured at the following site. http://www.flickr.com/photos/41284604 AT N05/3807724812/ Thank you. Ronald Cicerello Frankfort, KY USA BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Finally snow in Tromsø, N.Norway From: Vader Willem Jan Marinus <wim.vader AT UIT.NO> Date: Sun, 7 Feb 2010 09:55:18 +0100
FINALLY SNOW IN TROMSØ, N. NORWAY
This has been a somewhat uncommon winter here in N. Norway (but then, they
nearly all are, the term most fitting to our climate is changeability). We
usually have a clearly Atlantic weather type, with depressions coming in
from the Norwegian Sea and passing into the Barents Sea. Here in Tromsø
that often translates into strong southwesterlies, often with rain,
followed by the winds veering to the NW, often with snow. But this year,
for some reason, we have got a much more continental type of weather, with
long periods of dry and quite cold weather (Not very cold, mind you, we
live on an island close to the sea and surrounded by open salt water);
last week we set a new January record with -15.4*C (In the inland it may
be -40*C under such circumstances). As even this year we have had a few
episodes with rain, and very little snow on the ground, the minor streets
and forest paths have been dangerously icy and slippery for a long time,
and everybody walks around with 'brodder', thin soles with iron studs
bound under your shoes; even so, the hospitals register many more broken
wrists and legs than normally.
We got the sun back, after two months below the horizon, on 21 January,
and by now it is already daylight for five or six hours, making it a
little easier to see the dangers underfoot. And two days ago, it finally
also started snowing, and now we have some 30-40 cm (12-16 inches) of
fresh snow, while the temperature has climbed to just below freezing; from
tomorrow it will get colder again, though, with a return to the dry cold
weather and easterly winds for most of the week. This amount of fresh snow
would probably be a major problem many places in Europe and the US (where
people have to fight much more snow just now), but here people take it in
their stride, as a lot of snow is commonplace here, and both the town and
its inhabitants are well prepared; the sound of snow blowers is everywhere
in the air now. In fact , most Tromsø-people welcome this snowfall, as
conditions finally get much better for skiing, which is a most popular
pastime here, where one can start almost from ones own door. (Just today
there are also the annual reindeer-sledge races in town---as there was so
little snow, the organizers have been trucking in snow to our main street,
the venue of the races, for days, not knowing that enough snow would come
just in time from above!)
So what about the birds? There there is very little to tell; last time,
when I posted, my year list was at five species, and by now it has only
climbed to 12, the lowest total ever in early February. My feeders hang
almost unused, and my garden only is visited by Magpies, Hooded Crows, and
the occasional Feral Pigeons.My daughters saw a Treecreeper in the
Folkeparken nearby, but it is not yet on my list (There was one in the
garden in December). What is on the list are the Cormorant, the Common
Eider, Herring and Great Black-backed gulls, Feral Pigeon, Magpie, Hooded
Crow, and Northern Raven, Great and Willow Tit, House Sparrow and
Greenfinch; there is a roving flock of some 30 greenfinches in the area,
but for some reason they seem to largely avoid my garden this winter.
So there are few birds to see these days----if I had worked harder, the
list would have been some 5-10 species longer: a few more wintering ducks,
the White-tailed Sea Eagle , possibly a Sparrow Hawk or Goshawk, and
somebody even reported a Gyrfalcon just a few blocks away fro my house,
plucking a crow. But the icy roads do not make for long walks---now, with
the snow, it will be a bit easier perhaps, even though my skiing days are
over. And the view from the windows is fantastic; everything is white, and
the snow falls so heavily that even now, 10 am, ithe skies seem quite dark
still, but the snow reflects the light beautifully. N-Norway is the land
of the midnight sun, but for the most beautiful light effects you have to
come here in winter, when daylight is at a premium.
Wim Vader, Tromsø Museum
9037 Tromsø, Norway
wim.vader AT uit.no
BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html
Archives: http://listserv.arizona.edu/archives/birdchat.html
Subject: Re: Amazing things in birdingFrom: Jules Levin <ameliede AT EARTHLINK.NET> Date: Sat, 6 Feb 2010 22:38:28 -0800 At 03:28 PM 2/6/2010, you wrote: > For the second time, ( the first one last year in Jan), on ab electric >>wire near my office was a Black Kite which share a piece of a meat with a >>Pied Crow. My friend Paddy saw this similar suprise a few years ago. Haven't there been reports of crows cooperating with large predators in winter forests to locate prey or carcasses to be opened up? The crows do the spotting and then "lead" a predator to the spot. I wonder if something similar could be going on here. Jules Levin Los Angeles BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Re: Amazing things in birding From: Jerry Blinn <support AT AVISYS.NET> Date: Sat, 6 Feb 2010 16:28:40 -0700 Is it possible the kite(s) has learned that if he shares his catch with the crow he will get to keep half of it, as opposed to losing all of it to an aggressive, persistent crow?? Jerry >>>>>>>>For the second time, ( the first one last year in Jan), on ab electric >wire near my office was a Black Kite which share a piece of a meat with a >Pied Crow. My friend Paddy saw this similar suprise a few years ago. Jerry Blinn Perceptive Systems Placitas, NM 505-867-6255 jerry AT avisys.net Web Site: www.avisys.net BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Puerto Rico Trip Report From: Patrick Belardo <pbelardo AT YAHOO.COM> Date: Sat, 6 Feb 2010 15:25:21 -0800 I spent last week on a birding tour of Puerto Rico with Wild Hi All, I spent last week on a birding tour of Puerto Rico with Wildside Nature Tours. It was a blast. We saw/heard 15 of the 16 endemics plus tons of Caribbean specialties. We missed the Puerto Rican Parrot. I have a day-by-day trip report with photos on my blog: http://www.hawkowlsnest.com Patrick Belardo pbelardo-at-yahoo Piscataway, NJ http://www.hawkowlsnest.com BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Horned Guan From: Rick Wright <birdaz AT GMAIL.COM> Date: Sat, 6 Feb 2010 13:50:52 -0700 You can't do better than Hugo Enriquez: hugoharoldoenriquez AT yahoo.com Hugo is the co-leader of our Guatemala tour http://wingsbirds.com/tours/guatemala-highlands/ For more about San Pedro and its guans, see http://birdaz.com/blog/category/guatemala/ Best, -- Rick Wright Editor and Senior Leader, WINGS http://wingsbirds.com, http://birdaz.com/blog BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: rfi Horned Guan Guatemala From: Ronald Cicerello <sungrebe AT EARTHLINK.NET> Date: Sat, 6 Feb 2010 12:31:27 -0500 I'm going to try to see Horned Guan on Volcan San Pedro at Lake Atitlan in March. Can anyone recommend a San Pedro Volcano Park guide that has helped them to see the Guan? I've hear a gentleman named Mario has successfully lead others to the bird. Please share contact info. Thanks for your assistance. Ronald Cicerello Frankfort, KY. USA BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: BirdNote, last week, and the week of February 7, 2010 From: Ellen Blackstone <ellen AT 123IMAGINE.NET> Date: Sat, 6 Feb 2010 07:14:27 -0800 Hello, BirdChatters! Last week, BirdNote aired: * A Swirl of Snow Geese, a reflection by Barry Lopez http://www.birdnote.org/birdnote.cfm?id=539 * Birders and Hunters - and duck stamps http://www.birdnote.org/birdnote.cfm?id=1016 * Sizing Up Sharp-shinned Hawks http://www.birdnote.org/birdnote.cfm?id=1710 * Interview with Gerrit Vyn, sound recordist http://www.birdnote.org/birdnote.cfm?id=1430 * Myth of the Thunderbird - Teratornis merriami? http://www.birdnote.org/birdnote.cfm?id=580 * Consider the Ostrich - with a poem by Ogden Nash! http://www.birdnote.org/birdnote.cfm?id=582 * Bird of Two Colors, the Northern Fulmar http://www.birdnote.org/birdnote.cfm?id=1025 -------------------------------------------- Check out the photos accompanying next week's shows: http://bit.ly/b30fT5 ---------------------------------------------------------------------- BirdNote is a two-minute audio program, airing on several public radio stations and available by podcast: http://tinyurl.com/y24e8n. You can listen to the mp3, see a photo, and read the transcript on the website. All episodes are in the archives. Shows may vary by station. BirdNote's mission is to add to the voices supporting wildlife conservation and habitat protection. For people to ~protect~ something, they must love and understand it. BirdNote helps connect listeners to the natural world. Tell someone you know about BirdNote. Thanks! Ellen Blackstone http://www.birdnote.org Seattle, Washington BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Re: Amazing things in birding From: Gail Mackiernan <katahdinss AT COMCAST.NET> Date: Fri, 1 Jan 1904 04:35:19 -0500 Hi Herbert -- Once I heard a baby bird calling loudly for dinner. I followed the calls and found a young (feathered but still fluffy about the head and with short tail and primaries) Downey Woodpecker perched on a branch. While I watched, a much smaller Carolina Chickadee flew in with an insect and fed the Woodpecker! It flew off and soon was back with another offering. During this time I never saw the "rightful" mother. Normally woodpecker chicks would still be in their cavity nest at this age, so not sure what was going on -- just another amazing thing! Gail Mackiernan Silver Spring, MD on 02/06/2010 7:30 AM, Bird Uganda Safaris at director AT BIRDUGANDA.COM wrote: > Hi All, > This morning I went birding at the new shoebill site, purposely to count the > numbers one can see on a successiful day. It wasnt successiful though due to > the rain that suprised me after weeks of sunshine. I only saw one in a > distance. I decided to go to the office and do some few things here and > there. > > My office in near a market where they sell lots of stuff including meat and > fish. For the second time, ( the first one last year in Jan), on ab electric > wire near my office was a Black Kite which share a piece of a meat with a > Pied Crow. My friend Paddy saw this similar suprise a few years ago. > > I need scientists to help me understand why and how should this happen. > > Thanks > > Herbert > > BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Amazing things in birding From: Bird Uganda Safaris <director AT BIRDUGANDA.COM> Date: Sat, 6 Feb 2010 15:30:11 +0300 Hi All, This morning I went birding at the new shoebill site, purposely to count the numbers one can see on a successiful day. It wasnt successiful though due to the rain that suprised me after weeks of sunshine. I only saw one in a distance. I decided to go to the office and do some few things here and there. My office in near a market where they sell lots of stuff including meat and fish. For the second time, ( the first one last year in Jan), on ab electric wire near my office was a Black Kite which share a piece of a meat with a Pied Crow. My friend Paddy saw this similar suprise a few years ago. I need scientists to help me understand why and how should this happen. Thanks Herbert On Tue, Jan 26, 2010 at 4:58 AM, Katharine MillsSubject: RFI: South Florida guides From: Joe Byrnes <LBRoller AT VERIZON.NET> Date: Tue, 2 Feb 2010 20:05:32 -0500 Hi Mark, I was in Florida two weeks ago and birded with Larry Manfredi from Homestead (and he found me the La Sagra's Flycatcher). I was very impressed with him and recommend you check out his web page - http://www.southfloridabirding.com/. He knows the habitat, has led trips for more than twenty years, and is very knowledgeable about the species of South Florida. -Joe Byrnes Columbia, Md -----Original Message----- From: National Birding Hotline Cooperative (Chat Line) [mailto:BIRDCHAT AT LISTSERV.ARIZONA.EDU] On Behalf Of Mark Adams Sent: Tuesday, February 02, 2010 7:52 PM To: BIRDCHAT AT LISTSERV.ARIZONA.EDU Subject: [BIRDCHAT] RFI: South Florida guides Friends, I will visit south Florida (Miami and the Keys) in late May 2010 and would like to engage a guide for one or more days who could help me see and study regional specialities such as Spot-breasted Oriole, Red-whiskered Bulbul, White-winged Parakeet, Smooth-billed Ani, Common Myna, and others. If you have had relatively recent (the past 2 - 3 yrs) positive or negative experience with guides in south Florida, I'd value hearing from you privately at e-mail address below. Thank you for your assistance! Mark Adams markadamsphd AT yahoo.com Charlottesville, VA BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.html BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: RFI: South Florida guides From: Mark Adams <markadamsphd AT YAHOO.COM> Date: Tue, 2 Feb 2010 17:51:55 -0700 Friends, I will visit south Florida (Miami and the Keys) in late May 2010 and would like to engage a guide for one or more days who could help me see and study regional specialities such as Spot-breasted Oriole, Red-whiskered Bulbul, White-winged Parakeet, Smooth-billed Ani, Common Myna, and others. If you have had relatively recent (the past 2 - 3 yrs) positive or negative experience with guides in south Florida, I'd value hearing from you privately at e-mail address below. Thank you for your assistance! Mark Adams markadamsphd AT yahoo.com Charlottesville, VA BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Life lists From: Dinah Pulver <Dinah.Pulver AT NEWS-JRNL.COM> Date: Tue, 2 Feb 2010 19:26:16 -0500 For a story I'm working on, I'm curious about birding life lists. I'm working on putting my own list together, which seems to be approaching about 250. But how many birds is considered a lot? 700? 800? 1,000? Is there one group in the U.S. that sort of keeps track of the life listers with the most birds? If you care to comment, feel free to e-mail me privately at dinah.pulver AT news-jrnl.com. Thanks, Dinah Dinah Voyles Pulver Environment Writer Daytona Beach News-Journal Daytona Beach, FL 32117 dinah.pulver AT news-jrnl.com AT dinahvp news-journalonline.com/special/exotic news-journalonline.com/special/water news-journalonline.com/special/miamicorp BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: evolution of birds and bird-like dinos; interpreting fossils; free NATURE on your iPhone (links) From: Devorah Bennu <birdologist AT YAHOO.COM> Date: Mon, 1 Feb 2010 13:44:57 -0800 hello everyone, i have some excellent news for those of you who love to read original research (or essays about original research) published by NATURE: they are providing ALL of their content free to everyone's iPhone through the end of April. to upload the free iPhone app, go here; http://bit.ly/bqPavn i also wrote a story about a paper published by NATURE regarding errors in interpreting fossils of ancient soft-bodied vertebrates and marine animals; http://bit.ly/deCJi8 this paper has far-reaching implications for our understanding of evolution because the data suggest that the decay patterns of dead animals are not random prior to fossilization: their most derived characters decay first, which makes the fossils look more primitive than they really are. because there is a NATURE publicity video for this story, i asked the senior editor if they could make this paper "open access" and they agreed. this paper is freely available to anyone for two weeks, so be sure to download it to show them that their literature is important to the public. i also wrote a story about a new bird-like dinosaur that predates Archaeopteryx by 15-20 million years, showing that birds and bird-like dinos are not directly related; they evolved separately; http://bit.ly/cTWQJQ cheers, GrrlScientist http://scienceblogs.com/grrlscientist/ http://twitter.com/GrrlScientist http://profile.to/grrlscientist/ American Expat living in Frankfurt, Germany BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Mexican Duck re-split from Mallard From: "David J. Ringer" <djringer AT BIRDSTACK.COM> Date: Sun, 31 Jan 2010 17:14:40 -0600 Version 2.3 of the IOC World Bird List (December 2009) re-split Mexican Duck from Mallard. I looked up some of the papers cited in support of the decision and blogged some thoughts: http://djringer.com/birding/2010/01/30/mexican-ducks-are-not-mallards-probably/ I'd be interested to know whether there are significant studies I missed or different perspectives on the studies that have been done. David Vicksburg, Mississippi -- David J. Ringer http://djringer.com BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: RFI:Birding Brazil From: "Levine, Barron S" <LevineB AT bsd405.org> Date: Sun, 31 Jan 2010 14:29:36 -0800 Chatters and Tweeters,
Kate and I are contemplating doing a month long trip to Brazil this summer. For
those of you who are experienced in such said trip can you offer us some advise
about the following:
-Would an itinerary that would include the following (Iguaçu Falls, The
Pantanal, Christalino Lodge, and the SE Rain forest) be too ambitious?
-If not, how many days would you recommend at each? If so, what would you
eliminate? any other options
that you would think better than those stated for a first trip to Brazil?
-How does one (or 2 in this case) navigate around Brazil?
-Would you recommend for, or against driving at all, or part of the trip?
- If for, what route would you suggest?
-If flying would be best, what route should we take to help defray costs?
-Any one know of guides that are in the Pantanal region? We would rather not go
on a big tour and would
be looking mostly for someone to help us get to the birds and keep us from
getting lost. We always
enjoy working with the locals, so that we can also feel connected to the
culture.
--Any one have recommendations of guides, or lodges, that are in the SE region?
-Christalino has come highly recommended, but is very expensive. Any one have
other options that they
have used in the Mato Grosso area that they would rate as close to or
equivalent?
-For those of you who set up trips for yourselves, any tips that might help us
to save a few dollars would be greatly appreciated.
All the best
Barry Levine
levineb AT fastmail.fm
seattle
_______________________________________________
Tweeters mailing list
Tweeters AT u.washington.edu
http://mailman2.u.washington.edu/mailman/listinfo/tweeters
Subject: RFI:Birding BrazilFrom: "Levine, Barron S" <LevineB AT BSD405.ORG> Date: Sun, 31 Jan 2010 14:29:36 -0800 Chatters and Tweeters,
Kate and I are contemplating doing a month long trip to Brazil this summer. For
those of you who are experienced in such said trip can you offer us some advise
about the following:
-Would an itinerary that would include the following (Iguaçu Falls, The
Pantanal, Christalino Lodge, and the SE Rain forest) be too ambitious?
-If not, how many days would you recommend at each? If so, what would you
eliminate? any other options
that you would think better than those stated for a first trip to Brazil?
-How does one (or 2 in this case) navigate around Brazil?
-Would you recommend for, or against driving at all, or part of the trip?
- If for, what route would you suggest?
-If flying would be best, what route should we take to help defray costs?
-Any one know of guides that are in the Pantanal region? We would rather not go
on a big tour and would
be looking mostly for someone to help us get to the birds and keep us from
getting lost. We always
enjoy working with the locals, so that we can also feel connected to the
culture.
--Any one have recommendations of guides, or lodges, that are in the SE region?
-Christalino has come highly recommended, but is very expensive. Any one have
other options that they
have used in the Mato Grosso area that they would rate as close to or
equivalent?
-For those of you who set up trips for yourselves, any tips that might help us
to save a few dollars would be greatly appreciated.
All the best
Barry Levine
levineb AT fastmail.fm
seattle
BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html
Archives: http://listserv.arizona.edu/archives/birdchat.html
Subject: Oceanside (San Diego) Pelagic Trip Report 30JAN2010From: Terry Hunefeld <sdbirdlover AT FASTMAIL.FM> Date: Sun, 31 Jan 2010 11:38:51 -0800 Greetings, Photos and the trip report of yesterday's fourth annual Buena Vista Audubon Society “Seabirds, Whales and Dolphins†pelagic trip is now posted at: http://www.socalbirding.com/tripreports/oceansidejan302010.html Details for all upcoming Southern California Audubon Society pelagic trips for 2010 are posted at: http://www.socalbirding.com/upcomingtrips.html W. Terry Hunefeld, Encinitas Life is short. Seabird often. In memory of Luke Cole “Come on out with us to see what’s out there.†Southern California Seabirding Trips by: Buena Vista Audubon Society http://www.SoCalBirding.com Los Coronados Islands & Nine Mile Bank all the way to the edge of the Continental Shelf ---- W. Terry Hunefeld San Diego Life is short. Bird often. reply to: thunefeld AT gmail.com ---- -- http://www.fastmail.fm - The professional email service BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Dominican Republic Birding From: Tom Arny <tarny AT THERIVER.COM> Date: Sat, 30 Jan 2010 09:55:25 -0700 Having seen two postings relatively recently about birding in the DR and having seen no replies to the main list (though I gather people have posted to the inquirers), I thought I'd mention that I highly recommend Kate Wallace of Tody Tours as a guide in the DR. (www.todytours.com) . My wife and I spent 5-ish days in the DR in 2006 and were taken around by Kate. We had a great time and Kate showed us some really splendid birds .... Golden Swallow, two kinds of Todys, Lizard Cuckoo, Palmchat, etc. Tom Arny tarny AT theriver.com Box 545, Patagonia, AZ USA 85624 BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: BirdNote, last week, and the week of January 31, 2010 From: Ellen Blackstone <ellen AT 123IMAGINE.NET> Date: Sat, 30 Jan 2010 07:45:33 -0800 Hello, BirdChatters! Last week, BirdNote aired: * Paul Bannick Photographs the Great Gray Owl http://www.birdnote.org/birdnote.cfm?id=1556 * Why Arctic Terns Have Short Beaks http://www.birdnote.org/birdnote.cfm?id=1015 * How the Robin Got Its Name http://www.birdnote.org/birdnote.cfm?id=543 * Peregrine Comeback http://www.birdnote.org/birdnote.cfm?id=541 * Great Horned Owls Nest http://www.birdnote.org/birdnote.cfm?id=542 * Why Are Blackbirds Black? http://www.birdnote.org/birdnote.cfm?id=998 * Comparing Chickadee Calls http://www.birdnote.org/birdnote.cfm?id=527 -------------------------------------------- Check out the photos accompanying next week's shows: http://bit.ly/ckh2ou ---------------------------------------------------------------------- BirdNote is a two-minute audio program, airing on several public radio stations and available by podcast: http://tinyurl.com/y24e8n. You can listen to the mp3, see a photo, and read the transcript on the website. All episodes are in the archives. Shows may vary by station. BirdNote's mission is to add to the voices supporting wildlife conservation and habitat protection. For people to ~protect~ something, they must first love and understand it. BirdNote hopes to connect listeners to the natural world. Share BirdNote with someone you know. Thanks! Ellen Blackstone http://www.birdnote.org Seattle, Washington BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: "Cotingas" by David Snow From: "David M. Gascoigne" <bateleur27 AT HOTMAIL.COM> Date: Sat, 30 Jan 2010 07:59:01 -0500 I am trying to acquire a copy of "Cotingas" by David Snow. If anyone has a copy
they would like to sell, please email me.
Thank you.
David M. Gascoigne, 606 Osprey Drive, Waterloo, ON Canada N2V 2A5 519 725-0866,
Fax 519 725-1176, blog: travelswithbirds.blogspot.com
_________________________________________________________________
Say Happy New Year with Messenger for Mobile.
http://go.microsoft.com/?linkid=9706117
BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html
Archives: http://listserv.arizona.edu/archives/birdchat.html
Subject: URGENT CFP & Expressions of Interest - SoE meeting, Victoria BC, 5-8 May 2010From: bob gosford <bgosford AT GMAIL.COM> Date: Sat, 30 Jan 2010 12:09:30 +0930 Apologies for cross-posting Dear all, Further to recent notes about the SoE conference that will be held in Victoria BC the week prior to the ICE2010 conference in Tofino in May this year I am just following up to seek firm expressions of interest in your participation in a session dedicated to ethnoornithology at the SoE meeting - this would be in addition to the session that has been accepted for the ICE2010 meeting. The SoE conference homepage is here: http://ethnobiology.org/conference/upcoming - have a look at all the various pages and check times etc to ensure you can attend if you want to participate. So far I think we would have at least 3 participants (Henrik Moller & others in his group, myself - Bob Gosford & perhaps Fleur Ng'weno from Kenya). I've run a number of similar sessions at SoE meetings in the past - SoE meetings are quite different to ICE meetings and give some very different perspectives on ethnobiology that I have found most useful - that and you meet a whole lot of new colleagues to hang out with! And the field trips and meeting banquet are always good value!. Time is running short - the deadline for Abstract submission is 15 February and early bird registration (the SoE meeting fees are quite modest) is 1 March. Cheers and please be quick to get back to me if you have any queries or to express interest in attending - we need to get back to the SoE orgnisers to arrange a session as soon as possible. Bob Gosford -- Robert Gosford Crikey.com The Northern Myth blog http://blogs.crikey.com.au/northern/ Yuendumu, NT Australia Ph: (+61) 0447024968 BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: stunning mystery birds BIRD video, orange stripey dinosaurs? (links) From: Devorah Bennu <birdologist AT YAHOO.COM> Date: Fri, 29 Jan 2010 08:09:34 -0800 hello everyone, a friend sent me the link to a stunning video that features Andrew Zuckerman's photography of birds. i have featured this lovely video as the daily mystery birds, but it is so beautiful that you will want to just sit back, click "full screen", and watch as it unfolds. it'll make you fall in love with birds all over again; http://bit.ly/cNp9kj as always, i am always seeking mystery bird images to share with a large and appreciative audience, so be sure to contact me if you have some images to share. i also managed to get a copy of the latest NATURE paper about identifying feather color in dinosaurs that you will no doubt wish to read; http://bit.ly/cAO3nZ this is the first time that color has been identified in dinosaur feathers, and it was identified using a pioneering technique that i wrote about two years ago where color was identified in fossil feathers for the first time-- and the excited author of that paper popped in to my blog to talk to my readers (linked internally from this story). i am currently working on another dinosaur story (from SCIENCE) that i hope to publish later in the day, so you might wish to pop in later to read that, too. cheers, GrrlScientist http://scienceblogs.com/grrlscientist/ http://twitter.com/GrrlScientist http://profile.to/grrlscientist/ American Expat living in Frankfurt, Germany BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: BIRDERS! LOOKING FOR QUICK PASSAGE TO INDIA? From: Kamla Nambiar <ramkamla AT SYMPATICO.CA> Date: Fri, 29 Jan 2010 11:05:18 -0500 Hello Chatters, I returned from 3 weeks birding trip to India That far from Toronto was a tiring -job once 8 hrs to London, Amsterdam, Dusseldorf, depending on the Airline. 4 hrs brake in Europe. (coming back 7hrs brake). From Europe, 11 hrs flight reaching Mumbai at 11at night. My home in Calicut(Kozikode now) west coast farther south, and no flights at night. ended up taking in a hotel room -very expensive. Next morning 2hrs flight to Calicut. It appeared as though you were going to another planet.You had to retrace the same daunting route. We have to tip our hat at Sultans of EMIRATES Thanks to (Airbus-340-800)Toronto to Dubai 11 hours, a clean hotel room to sleep (8 min away) and coupons for dinner as well as breakfast all free. In the morning another Emirates aircraft 3 and a half hrs 500 people?)flight to Kozicode -a brand new clean air port(India), I am home.Way back to Toronto the same way. Way back I met a another Indian girl at Dubai breakfast table going another flight to LA. She also said she wouldn't fly by any other Internationals but Emirates. I saved nearly 7 hrs of flying time. Dubai may have financial problems. But the Sultans take care of their passengers really good. So peaceful and orderly.Workers are all from other countries. You don't have to be a Muslim to work in Dubai. But they don't give permanent residence anybody ,I was told. Who knows, at the rate they grow give chance to other nationalities, this may change that also. Outside Kerala State, I went to Bangalore, Delhi, Haryana, Chandigarh, towards Amritsar, not too far from India, Pakistan border. Delhi to Chandigarh by Car. I have taken about 240 pictures of Indian birds pictures. I will write about them later. Incidentally, a new airline in India is called KING FISHER. There at least 4 species in the sub-continent. The same owner has KING FISHER BEER which is popular even in Toronto. Good Birding Ram Ram Nambiar 351 Alexander Crescent Toronto. Ont L9T 6K7 ramkamla AT sympatico.ca . Ram nambiar www3.sympatico.ca/ramkamla/ BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Lesser Paradise Kingfisher at Saibai Island - Northern Myth blog & Crikey posts From: bob gosford <bgosford AT GMAIL.COM> Date: Fri, 29 Jan 2010 15:13:35 +0930 Dear all, Just a note further to Rohan Clarke's earlier post at Birding-Aus re finding a specimen of the *Lesser Paradise Kingfisher* (aka *Aru/Little Paradise Kingfisher*). I have a short piece in today's Crikey - *Bird of the week: Common Paradise Kingfisher* that can be seen here: http://www.crikey.com.au/2010/01/29/bird-of-the-week-common-paradise-kingfisher/ You will note that there is a mis-identification of the bird as a *Common Paradise Kingfisher*. This piece was filed with Crikey at about 9am Qld time before I jumped on a plane back home to Alice. Once I got home and checked my emails I noted Rohan's earlier post. I have corrected the mis-identification in the blog post at The Northern Myth. I also have a longer blog post at my Crikey blog The Northern Myth, with more photos etc here: http://blogs.crikey.com.au/northern/2010/01/29/roadkill-of-the-week-lesser-paradise-kingfisher-tanysiptera-hydrocharis/ You can also see more photos taken by Rohan at his excellent Wildlife Images site here: http://www.pbase.com/wildlifeimages/lesser_paradise_kingfisher As always your comments etc are welcome. Bob Gosford -- Robert Gosford Crikey.com The Northern Myth blog http://blogs.crikey.com.au/northern/ Alice Springs, NT Australia Ph: (+61) 0447024968 BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: RFI: Dominican Republic From: savagebirder <savagebirder AT SHAW.CA> Date: Thu, 28 Jan 2010 21:51:26 -0700 I am going to spend a few says in Punta Cana in mid-March. I will be staying at a hotel and will not have any of my own transportation. I am wondering about hiring a guide for a day to see some of the land birds. Has anyone done this? Thanks Sandra Savage Canada BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: dinosaur feather color and evolution of plumage, mystery bird (links) From: Devorah Bennu <birdologist AT YAHOO.COM> Date: Thu, 28 Jan 2010 13:43:00 -0800 hello everyone, i wrote a story about the new NATURE paper about feather color in dinosaurs that you might like to read. a few years ago, i also wrote a story about this same topic about a the grad student who inspired this work (linked from my story); http://bit.ly/cAO3nZ i also have a new mystery bird for you to identify. this time, it's a snow-print photographed near the Larsen Lake Blueberry Farm in Bellevue, Washington, kindly obtained by a seattle birding pal, Denny Granstrand; http://bit.ly/aH7L85 cheers, GrrlScientist http://scienceblogs.com/grrlscientist/ http://twitter.com/GrrlScientist http://profile.to/grrlscientist/ American Expat living in Frankfurt, Germany BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Re: starving brown pelicans From: "Jamie S." <woodpecker97330 AT YAHOO.COM> Date: Thu, 28 Jan 2010 08:25:06 -0800 More news on this from the Oregon birding list... Subject: Re: starving brown pelicans From: Mike PattersonSubject: Re: starving brown pelicans From: Kitty Jones <KITTYJONES2 AT AOL.COM> Date: Thu, 28 Jan 2010 07:32:17 EST Interestingly, I just watched a local news report in Baltimore, MD about a large group of brown pelicans that were rescued in the Chesapeake. They were freezing to death. I believe 14 of them died and the rest are being taken care of at some place in Delaware. In a message dated 1/28/2010 3:31:52 A.M. Eastern Standard Time, birdologist AT YAHOO.COM writes: hello everyone, i read a very sad news story today that says brown pelicans are starving in oregon "because of storms and high winds" in the area. while i don't doubt that storms and high winds are hampering their movements, this sounds to me to be a proximal cause. based on having lived in the seattle-portland area for most of my life, i'd guess that the ultimate cause for these birds' horrible deaths is human in origin: the fisheries on the west coast are severely damaged by pollution, overfishing and habitat loss, which makes the pelicans more susceptible to storms and high winds (link to news story); http://j.mp/bfmbBd i am curious to know what your thoughts on this matter are. GrrlScientist http://scienceblogs.com/grrlscientist/ http://twitter.com/GrrlScientist http://profile.to/grrlscientist/ American Expat living in Frankfurt, Germany BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.html BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: starving brown pelicans From: Devorah Bennu <birdologist AT YAHOO.COM> Date: Thu, 28 Jan 2010 00:31:26 -0800 hello everyone, i read a very sad news story today that says brown pelicans are starving in oregon "because of storms and high winds" in the area. while i don't doubt that storms and high winds are hampering their movements, this sounds to me to be a proximal cause. based on having lived in the seattle-portland area for most of my life, i'd guess that the ultimate cause for these birds' horrible deaths is human in origin: the fisheries on the west coast are severely damaged by pollution, overfishing and habitat loss, which makes the pelicans more susceptible to storms and high winds (link to news story); http://j.mp/bfmbBd i am curious to know what your thoughts on this matter are. GrrlScientist http://scienceblogs.com/grrlscientist/ http://twitter.com/GrrlScientist http://profile.to/grrlscientist/ American Expat living in Frankfurt, Germany BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Loudest, most voluminous wood warbler song From: William Saur <thepassionatebirder AT GMAIL.COM> Date: Wed, 27 Jan 2010 08:48:59 -0600 Folks: I would have to run with the Connecticut Warbler as the loudest wood warbler song. I find the loudness to be an auditory "field mark". Bill Saur De Forest, WI Mailto:thepassionatebirder AT gmail.comSubject: Alaska Tips From: KAREN FORCUM <tkforcum AT HUGHES.NET> Date: Tue, 26 Jan 2010 20:40:11 +0000 We are tenatively planning Alaska this summer. This would include driving with two small children.  We basically have the whole summer leaving around June 5 and would have to be back by early August. Of course our main focus is birding. A special interest would be driving up the Dempster Highway. We have a 4-wheel drive expedition. Another interest would be to fly down to Glacier Bay and ferry across to Kodiak Island. We wonder if we fly across to Nome, Gambel, or the Pribilofs-what would we be looking at with children and birding on our own without a guide? I am sure guides do not take children along anyway. We sort of wish not to have prior reservations so we can be flexible, but is that impossible. Our second main concern would be money? We are far from wealthy but this is a dream we have had for many years. Any tips will be much appreciated. You may reply to the email address below. Have a birder good day, Karen Forcum Mode, IL tkforcum AT hughes.net BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Ivory Gull in Georgia From: Brandon Best <sandfalcon AT GMAIL.COM> Date: Tue, 26 Jan 2010 14:28:09 -0500 Greetings all, Yesterday (1/25/10) an adult IVORY GULL was found at West Point Dam on the Georgia/Alabama border, just north of I-85 and the town of West Point, GA. It was seen again this morning (1/26) at sunrise, although very distantly. Evidently it returned to the dam around 12:30 EST, about an hour after I started my drive back home. Well, a look from a mile away is better than getting no look at all. If you want to check out the posts regarding this bird, go to either of these two sites: http://www.birdingonthe.net/mailinglists/GABO.html http://listserv.uga.edu/cgi-bin/wa?A1=ind1001&L=gabo-l Brandon Best Lawrenceville, GA BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Re: Loudest/Most Voluminous Wood-Warbler Call Note? Speculating Only...... From: Eric Lundquist <brewbird1 AT YAHOO.COM> Date: Tue, 26 Jan 2010 07:26:51 -0800 Either one of the Waterthrush species gets my vote. Reg Everyone- Either one of the Waterthrush species gets my vote. Regards, Eric Eric Lundquist Mundelein, IL brewbird1 [at] yahoo dot com ----- Original Message ---- From: Daniel EdelsteinSubject: Re: Loudest/Most Voluminous Wood-Warbler Call Note? Speculating On... From: Mary Beth Stowe <MiriamEagl AT AOL.COM> Date: Tue, 26 Jan 2010 08:13:21 EST In a message dated 1/22/2010 8:25:15 P.M. Central Standard Time, edelstein AT EARTHLINK.NET writes: No other wood-warbler species candidates' volume level come even close for me and TOWNSEND's wins easily in my experience If I were still living in San Diego I might agree, but the Yellowrumps out here in south Texas (Myrtle) have a very loud, robust chip to my ear, much louder than the Audubon's we'd get by the gazillions in winter back in So. Cal. In fact, that's how I'd find errant Myrtles--by listening for that robust chip! Mary Beth Stowe McAllen, TX _www.miriameaglemon.com_ (http://www.miriameaglemon.com/) BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Caracaras From: Katharine Mills <gkmills AT CHARTER.NET> Date: Mon, 25 Jan 2010 20:58:10 -0500 Hi,
I am entering my recent sightings for Crested Caracara's in Costa
Rica. My previous sighting for this species was seen in Honduras and in
Southern Texas. Those birds are now listed as Southern Caracara ,
Caracara plancus. Please let me know what has happened with the genus
and species for this bird.
Thanks,
Kathy Mills
BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html
Archives: http://listserv.arizona.edu/archives/birdchat.html
Subject: Hilton Pond 01/16/10 (Feeder Birds)From: "Bill Hilton Jr. (RESEARCH)" <research AT HILTONPOND.ORG> Date: Mon, 25 Jan 2010 18:44:16 -0500 As if the first two weeks of frigid January weather weren't enough, the past ten days at Hilton Pond Center have been beset with torrential rainfall and gray, overcast skies. Even on the darkest mornings, however, gazing at a bird feeder seems to brighten the weather considerably. For a peek at a cheery assortment of birds that came to one of our tube feeders in the span of just five minutes one day, please visit the 16-25 January 2010 installment of "This Week at Hilton Pond" at http://www.hiltonpond.org/ThisWeek100116.html. While there, be sure to scroll down for a list of birds banded and recaptured, as well as some general nature notes. Happy Nature Watching! BILL ========= RESEARCH PROGRAM c/o BILL HILTON JR. Executive Director Hilton Pond Center for Piedmont Natural History 1432 DeVinney Road, York, South Carolina 29745 USA (803) 684-5852 Please visit our web sites (courtesy of Comporium.net): Hilton Pond Center for Piedmont Natural History at http://www.hiltonpond.org "Operation RubyThroat: The Hummingbird Project" at http://www.rubythroat.org ================== BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: mystery bird challenge, red bird feathers, & evolution of long-distance migration (links) From: Devorah Bennu <birdologist AT YAHOO.COM> Date: Mon, 25 Jan 2010 09:52:31 -0800 hello everyone, i just published a mystery bird challenge for you to solve. this challenge features eight pictures of two species of ducks that are similar -- more similar than i realized until i started looking at the images and realized that i was unable to ID (with confidence) which individuals were which species. of course, i don't have any field guides here yet to assist me, but still .. these are not rare birds! i'd certainly appreciate your insight and input on these images and the "whys" of each ID you make; http://j.mp/644hHL [keep in mind that i publish a mystery bird every day, seven days per week, and i am always looking for more images to share with my readers, so please do contact me if you have pictures you'd like to share with a large and appreciative audience.] i published a story a few days ago that you might find interesting. this is a look at a scientific paper that was recently published that discusses the relationship between the brightness of carotenoid-based plumage, free radicals (no, not the political type) and sperm quality; http://bit.ly/57reLW i also wrote another story looks at the evolutionary reason that migratory birds fly so far north to breed when a more southerly location seems likely to serve them just as well, while costing them less effort. this study found that, in short, the birds are doing it for the kids; to improve the survival of their nestlings; http://bit.ly/755YFL GrrlScientist http://scienceblogs.com/grrlscientist/ http://twitter.com/GrrlScientist http://profile.to/grrlscientist/ American Expat living in Frankfurt, Germany BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Avoid unscrupulous people From: Bird Uganda Safaris <director AT BIRDUGANDA.COM> Date: Mon, 25 Jan 2010 17:28:59 +0300 Dear All, This is just to help those who may wish to get the information or are planning to travel to Uganda. There are 3 websites that have copied and pasted our content to their websites in trying to start business. These websites are www.birdafricatours.com, www.birdafricasafaris.com, and www.africsafaris.com. They have stolen, or copied and pasted our information from www.birduganda.com. Please deal with them at your own risk. Herbert -- Executive Director Bird Uganda Safaris Ltd 2nd Floor Jos House, Plot 55B, Opp. Fish Factory Telephone +256 312289048 Fax +256 (0)414222737 Cellphone +256(0)772518290/ 777912938 Email. director AT birduganda.com web www.birduganda.com East African Journeys BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Fwd: Rejected posting to BIRDCHAT@LISTSERV.ARIZONA.EDU From: The RIDERS <rider AT XCELCO.ON.CA> Date: Mon, 25 Jan 2010 00:02:54 -0500 >Date: Sun, 24 Jan 2010 19:05:01 -0500 >To: ALF >From: The RIDERSSubject: Ecuador Pictures From: "David M. Gascoigne" <bateleur27 AT HOTMAIL.COM> Date: Sun, 24 Jan 2010 18:40:02 -0500 We just added a series of pictures on our blog to complement the trip report
posted earlier.
David M. Gascoigne, 606 Osprey Drive, Waterloo, ON Canada N2V 2A5 519 725-0866,
Fax 519 725-1176 blog: www.travelswithbirds.blogspot.com
_________________________________________________________________
BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html
Archives: http://listserv.arizona.edu/archives/birdchat.html
Subject: Woodpecker experts haven't seen supposed Ivory-bill photosFrom: "gljeinwv AT juno.com" <gljeinwv@JUNO.COM> Date: Sun, 24 Jan 2010 13:49:14 GMT Ellen, Thank you for saying what most of us have been thinking. I for one am sick of hearing about Ivory-billed Woodpecker sightings. If though, someone can provide concrete evidence that they still exist, I'll be interested. If not, please do all of us a favor and shut up. Gary Felton Kingwood, WV ---------- Original Message ---------- From: Tim BoucherSubject: VS: Tromsø, at 70*N From: Vader Willem Jan Marinus <wim.vader AT UIT.NO> Date: Sun, 24 Jan 2010 12:26:34 +0100 In the last months , several people have again mailed me, asking how the
environment and climate are in Tromsø, N.Norway, where I live, and from
where I have sent out small pieces on birds and seasons for many years
now. I have therefore decided to send out anew a piece I wrote five years
ago, with excuses to all long-time subscribers. It saves me, maybe, to
replÿ to all individual mails on the subject.
Tromsø still has too littel snow, and far too much ice on all smaller
roads and paths, and temperatures are usually around or just below
freezing, so one really 'proceeds at ones own risk' when venturing
outside. My bird year list has by now climbed to 12 species, still much
lower than in most other years.
Wim Vader
TROMSØ, N. NORWAY, 70*N, FAR NORTH, BUT NOT ARCTIC
Since 1998 I have sent in short reports on the seasons and the bird life
in Tromsø, N.Norway; shortly after starting out, I think I included a
short report on the town and its surroundings, but now many of the
subscribers will be new since then, and several people have asked me
questions about 'my town', so I have decided to furnish some general
information once more.
To begin with, Tromsø is not really 'my town': I did not grow up here. I
moved from my native Holland to Norway (in first instance Bergen) in 1965,
when I married a Bergen marine biologist, Sunniva Lønning, whom I had met
during an excursion to Norway and Sweden of Leiden University students in
1961. We (by that time we had three children) moved to Tromsø in 1973, and
to my present house near Tromsø Museum, on the south end of the island of
Tromsøya, late in 1974 and we have lived there ever since.(Sadly, Sunniva
died in 1985). Also from 1973, I have worked as the Curator of 'everything
except the insects' at Tromsø Museum, the regional museum for N.Norway and
the Norwegian Arctic, that has existed in Tromsø since as early as 1871.
In 1976, the museum was incorporated in the then new University of Tromsø,
and since 1990 I am a full professor of zoology at the university (A
personal professorate, not a teaching appointment). I also no longer have
the responsibility for most of the vertebrate collections; these have been
taken over by colleagues, and I am now 'only' curator of fishes and
marine invertebrates. I am still a Dutch citizen, and since 1992, I also
have a Dutch partner; but Riet continues to live in Holland, so we meet
only during mutual visits or holidays.
The town of Tromsø is the capital of the province of Troms, the middle one
of the three provinces in N.Norway: Nordland, Troms, and Finnmark. When I
arrived in 1973, the town had ca 40 000 inhabitants, and was 'primus inter
pares' among N.Norwegian towns. But Tromsø has grown very quickly, and we
have now passed 60 000 inhabitants, and are clearly the largest center of
population in N.Norway and indeed in all of N.Scandinavia (excepting
Murmansk on the Kola peninsula, with its 500 000 people in a different
league altogether.) Tromsø is not a very old town; although there are
remains of a mediaeval fort on the island, the town recently celebrated
its 200 years as a township. The town has grown because of its situation
along the shipping lead along the Norwegian coast; as I said it lies on an
island, Tromsøya, surrounded by two sounds, that together form the sill of
the Balsfjord, one of the many justly famous Norwegian fjords. Most ships
that steam (or sailed) north along the Norwegian coast, follow a route
that as as much as possible leads through fjords and sounds, as the
climate up here is often stormy and the seas perilous. In addition to its
position as a centre for shipping, Tromsø has also become 'the gateway to
the Arctic': All the ships, and also nowadays all the planes to Svalbard,
start out from Tromsø, and the town is also one of the main fishing ports
in Norway. Take in addition its importance as a school and administrative
centre for all of N.Norway, and it is no wonder that Tromsø is the fastest
growing town in the country. Unfortunately!
Tromsø is not a beautiful town as such: the centre burned down several
times, the last time ca 40 years ago, and rebuilding was often done
quickly and economically rather than with an eye on beauty and
architecture. But the town is very beautifully situated on its
teardrop-shaped quite low island (highest point maybe 150-200m),
surrounded by the ca 1km broad sounds and by the high and usually snowclad
hills of the mainland and of the outlying large island of Kvaløya. The
nearest hills are ca 500m high, but behind them loom higher mountains, up
to 1200m, in a spectacular and thinly-populated area; no wonder that
hill-walking, mountaineering and skiing all are very popular with the
inhabitants. Tromsø also has a reputation as a very lively town, with a
spectacular number of cafes, restaurants and night clubs, much helped in
summer by the two months that the sun never sets; while the two months in
winter that the sun never rises above the horizon are a further good
reason for indoors revelries!!
Although we live at 70*N (and please look at a globus, and you will see
that everywhere else this means ice fields, or at the best bleak tundra),
we do not have an Arctic climate, and as everybody knows this is due to
the Gulf Stream, and the North Atlantic Current, that brings warm water
(all is relative, it gets never warmer than 14*C here, and we all swim
very briefly) up to these coast (and even to Svalbard) and cause our
coasts to be ice free and our climate to be boreal-atlantic rather than
arctic. Winters are long here---it may snow in every month of the
year---, but they are not unduly harsh, and the minimum temp. ever
recorded is in fact not below -20*C, which does occur also in Holland now
and then. Winters may also be very snowy, although, just as everything
connected with the weather up here, conditions are most variable: this
year all snow was gone on 28 April, while 5 years ago we set a new snow
record, with 2.43m snow on the ground, on 29 April and that year the last
snow in my garden melted 22 June!
But we do have plenty of forest here, puny though it may be by the
standards of many other people. Here at the coast the natural vegetation
is birch forest, with Alder, various Willows, Rowan and Aspen, while in
the inland Pines dominate. None of the trees get much higher than maybe
5m, though, and the tree line in the hills here around Tromsø lies at ca
250-300m. Above there heath dominates,with a lot of edible berries, and
with the only 'trees' small creeping willows and the horizontal Dwarf
Birch Betula nana.
The geology of the area is very varied, and there is in fact a large fault
straight across Tromsøya and the surrounding hill-country. To the south of
it, and that includes the southern half of the island, and thus also the
terrain around the museum and my house, the ground is chalk-rich and the
vegetation luxuriant; the hills to the south of Tromsdalen on the
mainland, accessible by cable car to Storsteinen at ca 400m, are very
famous in botanical circles for their rich flora and they also look very
colourful in summer when the fields of white Dryas bloom. While the area
further north has much harder and more acid rocks and consequently a much
poorer vegetation; the marshes at Rakfjord, one of the better birding
areas, lie in this region.
The houses in Tromsø, outside the very centre downtown, are mostly wooden
free standing houses (An own house and own garden is the dream of every
Norwegian), while, characteristic for this area. most people do not fence
in their gardens, so that the different gardens just kind of merge into
each other, which gives a very pleasant effect indeed. The houses, most of
them well-known models from one of the leading house factories, are
moreover painted in all possible colours (and some that hardly seem
possible) and also that helps giving our suburbia a very colourful and
appealing image. (Outside the town, of course, people do fence in their
gardens, as there free-roamin sheep and reindeer otherwise would eat
everything. But on the island we do not have this problem).
The fact that everybody aspires to his own house has also the consequence
that the town spreads like an oil stain over the landscape, as it grows.
When I arrived in 1973, I hardly saw any lights across the sound on the
shores of Kvaløya in the evening, and now that whole area is also built
full with villas, as is the corresponding area on the mainland. Recently,
the town fathers have realized the problem, and now there are several
schemes with larger buildings containing flats, mainly along the sound,
where the areas were mainly small-industrial before (There is no large
industry in Tromsø); one of these schemes also has been built along the
shore down the street from where I live, on the slope maybe 50m above sea
level, with a beautiful view across the sound.
This growth, although very good in many ways, of course has had clear
negative consequences for the nature and birdlife in the area. When I
arrived in Vesterli---where I live now--- in 1974, and walked through the
remnant birch forest patch called Folkeparken--- a bit of a holy cow for
the people of Tromsø, so it has remained largely unscathed for the
building boom---, I regularly saw and heard Willow Grouse, even in my
garden, while Snipe and Redshanks nested on the grassland adjoining the
Folkeparken, and Bluethroats were heard here regularly. Now all that has
gone, and only the Oystercatchers remain; these adaptable birds now nest
on the flat roof of the TV studios and music conservatorium, built where
earlier the grassy meadows were. And in Folkeparken not only the
Bluethroats are gone, but also the Garden Warblers, the Sedge Warblers,
and since two years also the Woodcock that miraculously hung on to its old
haunts in the area is not seen displaying anymore here. All these birds
have of course not disappeared from Tromsø altogether; Willow Grouse
f.ex. often gladdened my heart on the university campus when I lectured
there, and also Bluethroats and Sedge Warblers are common enough in the
marshy areas on the less-densely populated northern half of the island.
But the Temminck's Stints that used to nest near the airport, and that
were disturbed by the road works there a few years ago, were the last ones
on the island, I think We now boast a 4-lane road here, but no longer have
nesting Temminck's Stints. (I have refound a few in their old haunts
m\near the airport in 2009!). There is little doubt, what most people also
here, judge to be the greater good!.
Folkeparken is thus a remnant birch forest on very rich soil, and thus
also with an extremely luxuriant undergrowth. There are conifer
plantations in the 'park', mostly fir, but also some pine and even larch,
and they increase diversity, and attract inland birds on their periodic
invasions to the coast, to a degree that they even now and then stay to
nest the following year(s): we have seen thus with Crossbills, Coal Tits
and Goldcrests, and in recent years (but not in 2003) we also had the
pleasure of singing European Robins in Folkeparken, while also the Wood
Pigeon is seen here regularly. But the mainstay remains the big five of
the birch forests: Fieldfare, Redwing, Willow Warbler, Brambling and
Redpoll.
This brings me to the subject of the dynamics of our avifauna. There have
been an amazing number of changes in our Tromsø bird world since 1973. The
first wave of newcomers, or rather 'my first wave', in the seventies
(House Sparrows, Great Tits and Pied Flycatchers had invaded earlier) were
the Greenfinch (now one of the most numerous birds not only in Tromsø, but
al the way to the Russian border), the Chiffchaff (now also quite common)
and the Blackcap (which has not made it and is now heard only
occasionally). Then, and no doubt by an entirely different mechanism, came
the rise of the Gray Heron, now also a common nesting bird even on the
island, and a integral part of the vistas along the fjord
intertidals)----I vividly remember the first flight I saw here: a perfect
V of nine birds, which to my great surprise were not geese or cormorants ,
but herons. During the last years, as I said the Wood Pigeon and the
European Robin, previously typical inland birds, are gradually spreading
to the coast, while we already possibly see the forerunners of the next
invasion: both the Blue Tit and the Jay (neither of them migrant birds)
are being reported more and more frequently in mid Troms, although both
are still rare birds, certainly here on the island. (In 2009 I had for
the first time Blue Tits in my garden, and this autumn even a Winter
Wren!). And some other birds, such as the Wood Warbler and the Icterine
Warbler are being heard and seen in the inland, and may later on also
extend their area to the coast here.
Finally, I want to stress the fact that the density as well as the
diversity of birds here is much lower than at lower latitudes. In other
words, you will not only see fewer species of birds, but also much fewer
individuals when you come here (Of course our famous seabird cliffs are an
exception to this rule, and it is anyhow more clear for terrestrial birds
than for waterbirds). I have written earlier about the differences between
Riet's little village garden full of birds in Holland, and my much larger
garden, with many trees, where there are no birds at all for long periods
at a time, apart from the 'house magpie family' and the roaming Common
Gulls in summer, and the Greenfinches, Great Tits and Willow Tits on the
feeder in winter. There is nothing particularly wrong with my garden, this
is just the difference between 50 and 70*N.
Wim Vader, Tromsø
Museum
9037 Tromsø,
Norway
wim.vader AT uit.no
BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html
Archives: http://listserv.arizona.edu/archives/birdchat.html
Subject: Sax-Zim Bog Bird Festival - Last weekFrom: Michael Hendrickson <mlhendrickson AT YAHOO.COM> Date: Sat, 23 Jan 2010 16:53:54 -0800 Hello: This will be the last week of registrations for the 3rd Annual Sax-Zim Bog Winter Bird Festival being held on Feb 12-14th in Meadowlands, MN. Since my last posting Great Gray Owls look like they headed back in the woods but in the last week or so Great Gray Owls seem to make a rebound and have been seen a few times in the Sax-Zim Bog! Thank goodness. The feeders in the Sax-Zim Bog are still attracting Boreal Chickadees, Pine Grosbeaks, Common Redpolls and other winter residents. Black-backed Woodpeckers are being seen on most days along with Northern Hawk Owls! In Duluth there are still good places to view Bohemian Waxwings and the big news is the number of gull species being seen. Good numbers of Iceland Gulls in various ages, Thayer's Gulls, Glaucous Gulls and Great Black-backed Gulls. Also are Barrow's Goldeneye is still being seen among a large raft of Common Goldeneyes. In Aitkin County good numbers of Northern Hawk Owls and the big draw will be the Sharp-tailed Grouse displaying on their lek! There is a lot to be found and seen during the festival. To read more about the festival go here: http://moumn.org/sax-zim/ There will be bird field trips going to Sax-Zim Bog, Aitkin County and Duluth. There will also be a winter photo workshop led by Mark "Sparky" Stensaas and Shawn Zierman. Here birders will learn about winter photography and visit a private feeder to photograph winter finches. Along with the workshop and birding field trips there will also be speakers, vendors and much more! Thanks for your time! Mike Mike Hendrickson Duluth, Minnesota Website: http://webpages.charter.net/mmhendrickson/ Blog: http://colderbythelakebirding.blogspot.com/ BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Woodpecker experts haven't seen supposed Ivory-bill photos From: Tim Boucher <tboucher AT GEOCITIES.COM> Date: Sat, 23 Jan 2010 13:31:55 -0700 The best thing about this purported sighting is that the whole thing is so ludicrous that everyone agrees and there is nothing to fight about. Ellen Paul Bethesda MD BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: BirdNote, last week, and the week of January 24, 2010 From: Ellen Blackstone <ellen AT 123IMAGINE.NET> Date: Sat, 23 Jan 2010 07:48:52 -0800 Hello, BirdChatters! Last week, BirdNote aired: * Sounds of the Amazon http://www.birdnote.org/birdnote.cfm?id=523 * Birdbaths in Winter http://www.birdnote.org/birdnote.cfm?id=528 * Early Bird? Who ~really~ gets the worm? http://www.birdnote.org/birdnote.cfm?id=533 * John Burroughs I http://www.birdnote.org/birdnote.cfm?id=995 * John Burroughs II http://www.birdnote.org/birdnote.cfm?id=996 * Jynx! the Eurasian Wryneck http://www.birdnote.org/birdnote.cfm?id=534 * Northern Spotted Owl http://www.birdnote.org/birdnote.cfm?id=524 -------------------------------------------- Check out the photos accompanying next week's shows: http://bit.ly/7cz99k ---------------------------------------------------------------------- BirdNote is a two-minute audio program, airing on several public radio stations and available by podcast: http://tinyurl.com/y24e8n. You can listen to the mp3, see a photo, and read the transcript on the website. All episodes are in the archives. Shows may vary by station. BirdNote's mission is to add to the voices supporting wildlife conservation and habitat protection. For people to ~protect~ something, they must love and understand it. BirdNote helps connect listeners to the natural world. Tell someone you know about BirdNote. Thanks! Ellen Blackstone http://www.birdnote.org Seattle, Washington BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Loudest/Most Voluminous Wood-Warbler Call Note? Speculating Only...... From: Daniel Edelstein <edelstein AT EARTHLINK.NET> Date: Fri, 22 Jan 2010 21:24:52 -0500 .....and wondering if others have an opinion? My own is based on listening to wood-warblers for 30 years and, perhaps interestingly, the TOWNSEND's WARBLER call note sounds louder to me by far than BLACK-THROATED GREEN -- with, as many of you may know, both of them Dendroica genus members and considered two of the five members of the so-called Black-throated Green Super Species by some theorists/researchers accounts. No other wood-warbler species candidates' volume level come even close for me and TOWNSEND's wins easily in my experience -- including today when our near-Biblical northern CA rains finally stopped (8"-10" in three days where I live, according to the gauge) and, as a result, the "over-wintering" TOWNSEND's were out in abundant numbers actively foraging/gleaning. I estimate that I heard a new individual's call note every 100-150' on my forest walk and on lands adjoining our place. Of course, my opinion here is subjective. I don't pretend to have empirical evidence for my claim above. For instance: My ears may hear sounds at different levels than yours/other people. So, as a reference point, I consider YELLOW-RUMPED WARBLER (Audubon's subspecies) to have a call note that is 1/2 to 2/3rds as loud as TOWNSEND's. Your thoughts? Good birding and happy weekend, Daniel Edelstein Novato, CA (Bay Area) & Ellison Bay, WI http://www.warblerwatch.com My two blogs: http://warblerwatch.blogspot.com (my blog devoted to wood-warblers) http://danielsmerrittclasses.blogspot.com (my blog focused on classes I teach at Merritt College in Oakland, CA, including my next one -- "Bird Song Ecology/Birding By Ear" that begins in 4/10) 12 Kingfisher Court Novato, CA 94949-6628 USA 415-382-1827 (voice & DSL fax) BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Texas Whooping Cranes (21 January 2010) census update From: Patty Waits Beasley <hawks AT CCBIRDING.COM> Date: Fri, 22 Jan 2010 14:21:05 -0600 Greetings all,
The following report is forwarded with permission from Tom Stehn, USFWS
biologist and US Whooping Crane Coordinator.
------------- begin report --------------
The fifth aerial census of the 2009-10 whooping crane season was conducted
January 21, 2010 in a Cessna 210 piloted by Gary Ritchey of Air Transit
Solutions of Castroville, Texas with USFWS observer Tom Stehn. Sighted on
the flight were 235 adults and 18 juveniles = 253 total whooping cranes.
This was 10 birds less than the last flight conducted 1-05-10. However,
flight time was limited by fog that did not burn off until 10:30 AM, so some
cranes were presumably overlooked, as search time had to be condensed. More
telling than the total number of cranes tallied was the distribution
observed that seemed to confirm the estimated flock size. However, it
definitely appears that one juvenile has died since arriving at Aransas.
This juvenile had been found in the refuge's South Sundown Island territory.
On today's flight, a pair believed to be the S. Sundown Island pair was seen
very close to their territorial neighbors to the south. It seemed clear
that I was looking at adjacent territorial pairs, and that the S. Sundown
Island pair was missing its chick. It is also possible that the Dewberry
Island pair at Welder's Flats has lost their chick, but it is also possible
they had moved over to the refuge's Power Lake on Matagorda Island where
there was an unexpected family.
The territories of adult cranes remain difficult to figure out as many of
the crane pairs have left their marsh and are searching for food on the
uplands. On today's flight, an unusually high 52 cranes were on unburned
uplands, 4 were on the C14 refuge burn, 13 were in open bays, two were at a
game feeder south of the Big Tree on Lamar, and 182 (72%) were in salt
marsh. Blue crabs are at extremely low levels and the cranes are having to
look for other sources of food. This is a very stressful time of winter for
the whooping cranes. One additional juvenile that apparently separated from
its parents during migration was sighted near Medford, Oklahoma December
14-25 has not been re-sighted but is presumably doing okay in an unknown
location.
The flock size is currently estimated at 244 adults + 19 juveniles = 263.
January 21st - Recap of whooping cranes (253) found at Aransas:
Adults + Young
San Jose 58 + 4 = 62
Refuge 53 + 5 = 58
Lamar 16 + 1 = 17
Matagorda 84 + 6 = 90
Welder Flats 22 + 2 = 24
Hynes Bay 2 + 0 = 2
Total 235 + 18 = 253*
* The presence of one chick last seen in Oklahoma makes the current
estimated flock size 263, including 19 chicks. One chick has died since
arriving at Aransas.
One whooping crane was sighted on 1/17/10 by a TPWD biologist on the Smith
Marsh in Matagorda County. The Smith Marsh is private property just to the
west of the Nature Conservancy's Mad Island Marsh Preserve a considerable
ways up the coast from Aransas.
Flight Conditions: Visibility was excellent throughout the flight, though
the sun angle on late afternoon transects made for difficult viewing
conditions when heading into the sun. Winds were light and flight
conditions were smooth, enabling us to travel at approximately 130 knots for
most of the flight. Due to reported crane movements, the search area was
expanded much further out into upland areas. However, only three additional
cranes were found in the uplands at Welder Flats, whereas 12 had been
located there the previous week. This difference seemed to account for the
10 fewer cranes found on today's flight compared to the previous flight. In
addition, no cranes were found at the refuge's Burgentine Lake, whereas
seven had been present on the previous flight. The largest group size
observed was seven birds seen on the uplands on San Jose and in the marsh on
Matagorda Island.
- Tom Stehn, Aransas National Wildlife Refuge
------------- end report ----------------
Tom Stehn, Whooping Crane Coordinator
U.S. Fish and Wildlife Service
Aransas NWR
P.O. Box 100
Austwell, TX 77950
(361) 286-3559 Ext. 221
fax (361) 286-3722
E:mail: tom_stehn AT fws.gov
Where applicable, CWS stands for Canadian Wildlife Service; USFWS is US Fish
and Wildlife Service. Crane monitoring involves cooperative efforts and
support by both countries, plus many volunteers and non-profit organizations
along the way.
All reports are posted on the Texas Whooping Crane website
(www.ccbirding.com/twc).
~~~~~~~~~~~~~~~~~~~~~~~~~~
Patty Waits Beasley
Corpus Christi, Texas USA
Texas Whooping Cranes
www.ccbirding.com/twc/
~~~~~~~~~~~~~~~~~~~~~~~~~~
BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html
Archives: http://listserv.arizona.edu/archives/birdchat.html
Subject: vortex binosFrom: Michael Wiegand <onwingsof_pearl AT HOTMAIL.COM> Date: Fri, 22 Jan 2010 12:11:29 -0700 anyone out there have a opinion on Vortex Fury binos? (8x42)
Michael Wiegand
Pearl, Idaho
208-859-3643-c
208-286-0506-h
www.habiscapes.com
"the truth is out there!"
BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html
Archives: http://listserv.arizona.edu/archives/birdchat.html
Subject: Woodpecker experts haven't seen supposed Ivory-bill photosFrom: Matt Mendenhall <mmendenhall AT KALMBACH.COM> Date: Fri, 22 Jan 2010 13:03:20 -0600 In the last few days, fresh claims of an Ivory-billed Woodpecker sighting have been made from the Sabine River area along the Texas/Louisiana border. The person claiming the sighting says he has photos, but he hasn't shown them yet to woodpecker experts Van Remsen or Jerry Jackson. You can read more about their reaction on our blog: http://bit.ly/8tthmC Matt Mendenhall Associate Editor Birder's World BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: About that photo in Birding magazine... From: Ted Floyd <tedfloyd57 AT HOTMAIL.COM> Date: Fri, 22 Jan 2010 03:56:41 -0800 Hello, BirdChatters. Several folks have asked me offline about the famous birders in the photo on p. 54 in the January 2010 issue of Birding. (This is the lead photo in the Ted Eubanks commentary.) I'll say below who they are, but, first, a thought of my own. Long-time birders may recall a note by Martin Reid in Birding magazine, back in 1999, which posed the question, "Why Are We So White?" (Birding, February 1999, p. 12.) Martin's letter resulted in gazillions of responses--some of them vitriolic, some of them panegyrical; many of them superficial, a few of them quite profound. Clearly, he touched a nerve! Fast-forward to 2003. I was in Spain, hanging out with some of the great Euro-birders, and "The Martin Reid Question" came up. The assessment by the Europeans was that Americans were doing a good job of recruiting birders from among the ranks of its non-white, non-male, and non-elderly population. That was gratifying for me to hear, but I was a little skeptical. I guess the question for me in 2003 would have been, "Why are we old, white, and male?" Fast-forward to 2010. Looking at the OTHER lead photo in the Eubanks commentary (p. 55), I haveta say, I think we really are making progress. For sure, work remains to be done; just check out the memberships of most bird records committees and state ornithological society boards... But, again, I think we're getting there. That image on p. 55 says to me that we've achieved a "critical mass" of demographic diversity in the American birding community, and I, for one, am excited by what lies ahead. Oh, and here are the names of the folks in the photo on p. 54: Back row, left to right: John Sterling, Dave Shuford, Guy McCaskie, Jeri Langham, Joe Morlan, John Luther, Al Demartini, Tim Manolis. Front row, left to right: Ed Harper, Bruce Deuel, Don Roberson, Steve Summers, Kimball Garrett. Also, here are folks in the photo on p. 55: First row, left to right: Jo Anna Leachman, John Garrett, Barbara Ballentine, Neil Gilbert, Jennie Duberstein, Noah Strycker. Second row, left to right: Clark Jones, Anna Wiker, Dudley Edmondson, Jessie Barry, Nick Block, Jen Brumfield. Third row, left to right: Catherine Ortega, Michael Retter, Justina Parsons-Bernstein, Luke DeCicco, Donna Dittmann, John Robinson. Fourth row, left to right: Ernesto Ruelas Inzunza, Tayler Brooks, Cameron Cox, Caitlin Kight, Gehan de Silva Wijeyeratne, Saraiya Ruano. Fifth row, left to right: Amy Hooper, Cin-Ty Lee, Caroline Van Hemert, Lin Jianyang, Dorit Liebers, Alvaro Jaramillo. ------------------------------- Ted Floyd Editor, Birding Check out Birding magazine on Twitter: http://twitter.com/BirdingMagazine ------------------------------- _________________________________________________________________ Hotmail: Trusted email with powerful SPAM protection. http://clk.atdmt.com/GBL/go/196390707/direct/01/ BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Re: Audubon: The Flicker Years From: "snorkler AT juno.com" <snorkler@JUNO.COM> Date: Thu, 21 Jan 2010 19:30:36 GMT The Flicker years will go down as disastrous ones for National Audubon, coinciding with vastly decreased membership and national influence. Local chapters withdrew by the thousands, and set up local memberships, struggling with decreased national revenue shares. I could go on, but don't want to appear overwhelmingly negative. Darrell Lee Alameda, CA BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Audubon: The Flicker Years From: Rob Fergus <birdchaser AT HOTMAIL.COM> Date: Thu, 21 Jan 2010 09:09:52 -0600 John Flicker poured 15 years of his life into Audubon. Some of what he proposed
was great and worked well, other stuff maybe not so much. What worked and what
didn't work, and what if anything should Audubon think about changing under new
leadership? Interesting to have this take place in light of the discussion in
Birding and here about who will speak for birders. I've got my own take on it,
but would love to hear from others :-)
http://birdchaser.blogspot.com/2010/01/audubon-flicker-years.html
Rob Fergus
Perkasie, Bucks, Pennsylvania
http://birdchaser.blogspot.com
_________________________________________________________________
Hotmail: Trusted email with Microsoft’s powerful SPAM protection.
http://clk.atdmt.com/GBL/go/196390706/direct/01/
BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html
Archives: http://listserv.arizona.edu/archives/birdchat.html
Subject: Flicker resigns, top ornithologist and birder Frank Gill to head up Audubon for nowFrom: Rob Fergus <birdchaser AT HOTMAIL.COM> Date: Wed, 20 Jan 2010 19:57:08 -0600 After 15 years at Audubon, John Flicker has resigned. Frank Gill will head up
Audubon while a new president is recruited.
Frank Gill is a top ornithologist, serious birder, and a great guy.
First time Audubon has had a serious bird guy at the head in decades. Can't
help but think this bodes well for the birds!
http://birdchaser.blogspot.com/2010/01/new-audubon-chief-frank-gill.html
Rob Fergus
Perkasie, Bucks, Pennsylvania
http://birdchaser.blogspot.com
_________________________________________________________________
Your E-mail and More On-the-Go. Get Windows Live Hotmail Free.
http://clk.atdmt.com/GBL/go/196390709/direct/01/
BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html
Archives: http://listserv.arizona.edu/archives/birdchat.html
Subject: Trip report Ecuador December 18, 2009 - January 4, 2010From: "David M. Gascoigne" <bateleur27 AT HOTMAIL.COM> Date: Wed, 20 Jan 2010 20:52:56 -0500 I just posted a trip report to my blog at travelswithbirds.blogspot.com
covering a recent fabulous visit to Ecuador for the period mentioned above. For
some reason I had a great deal of trouble posting this report, even though I
have done it many times before. It is actually posted as a consecutive series
of one day trip reports. We are still editing the almost 3,000 pictures we took
and will be posting a series of images later.
David M. Gascoigne, 606 Osprey Drive, Waterloo, ON Canada N2V 2A5 519 725-0866,
Fax 519 725-1176 Blog: travelswithbirds.blogspot.com
_________________________________________________________________
BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html
Archives: http://listserv.arizona.edu/archives/birdchat.html
Subject: [Fwd: Help Shape the Future of Po int Pelee / Aidez-nous à définir l?aven ir de la Pointe-Pelée]From: bruce <brucep AT MNSI.NET> Date: Wed, 20 Jan 2010 18:34:47 -0500 Sorry this is kinda short notice but does anyone have anything they
would like to bring fwd I will be at the meeting thursday
Bruce
-------- Original Message --------
Subject: Help Shape the Future of Point Pelee / Aidez-nous à définir
l?avenir de la Pointe-Pelée
Date: Fri, 15 Jan 2010 10:17:47 -0600
From: Pelee.Info AT pc.gc.ca
To: Pelee.Info AT pc.gc.ca
Help Shape the Future
Parks Canada is undertaking a review and updating of the park management
plan for Point Pelee National Park. The Park Management Plan is a
forward-looking, fifteen-year document that is publicly reviewed every
five years. The plan provides a vision of the park at its future best
and the strategies for how that will be achieved.
The Park Management Plan also highlights the opportunities and
challenges the park faces. The strategies and approaches defined in the
plan create a 'road map' for delivery of the three elements of Parks
Canada's mandate - protection, visitor experience, and public education.
Your participation is important. The values and views of Canadians are
at the core of the Park Management Plan. We invite you to attend a
meeting to learn about the park's challenges and opportunities and to
share your ideas, views, opinions and thoughts.
Date: Wednesday, January 20, 2010
Time: 7:00pm
Location: Pelee Days Inn & Conference Centre
566 Bevel Line Road
Leamington, Ontario
Or
Date: Thursday, January 21, 2010
Time: 1:30pm
Location: Pelee Days Inn & Conference Centre
566 Bevel Line Road
Leamington, Ontario
For more information or if you are unable to attend a meeting visit the
website at parkscanada.gc.ca/PointPelee or call 519- 322- 2365 to
request a copy of the Park Management Plan Review newsletter.
Information:
Marian Stranak
Park Superintendent,
Point Pelee National Park
Parks Canada
519-322-2365 [212]
If you do not want to receive any further information from the park,
please reply to pelee.info AT pc.gc.ca
Aidez-nous à définir l'avenir
Parcs Canada entreprend l'examen et la mise à jour du plan directeur du
parc national de la Pointe-Pelée. Le plan directeur est un document
prospectif de quinze ans qui doit faire l'objet d'un examen public à
tous les cinq ans. Il présente une vision du parc dans son état optimal
souhaité pour l'avenir et les stratégies qui permettront d'y parvenir.
Le plan directeur du parc met également en lumière les possibilités et
les défis devant lesquels se trouve le parc. Les stratégies et les
approches définies dans le plan établissent l'orientation à suivre pour
intégrer les trois volets du mandat de Parcs Canada - la protection,
l'expérience du visiteur et l'éducation du public.
Votre participation est importante pour nous. Les valeurs et les
opinions des Canadiens et Canadiennes sont au coeur du plan directeur du
parc. Nous vous invitons à une réunion afin que vous puissiez vous
renseigner sur les défis et les possibilités qui se présentent au parc
et partager avec nous vos idées, points de vue, opinions et réflexions.
Date : Mercredi 20 janvier 2010
Heure : 19 h
Endroit : Pelee Days Inn & Conference Centre
566 Bevel Line Road
Leamington, Ontario
Ou
Date : Jeudi 21 janvier 2010
Heure : 13 h 30
Endroit : Pelee Days Inn & Conference Centre
566 Bevel Line Road
Leamington, Ontario
Si vous désirez obtenir de plus amples renseignements ou si vous ne
pouvez assister à une réunion, visitez le site Web au
parcscanada.gc.ca/pointepelee ou appelez au 519-322-2365 pour obtenir
une copie du bulletin sur l'examen du plan directeur du parc.
Information:
Marian Stranak
Park Superintendent,
Point Pelee National Park
Parks Canada
519-322-2365 [212]
Pour ne plus recevoir de correspondance du parc, veuillez nous faire
parvenir un courriel a pelee.info AT pc.gc.ca
BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html
Archives: http://listserv.arizona.edu/archives/birdchat.html
Subject: Ted Eubanks commentary in January 2010 BirdingFrom: Ted Floyd <tedfloyd57 AT HOTMAIL.COM> Date: Wed, 20 Jan 2010 08:11:04 -0800 Hello, BirdChatters. The January 2010 issue of Birding contains a commentary by Ted Eubanks on "Who Advocates for Birding?" The article is available as a PDF download from the ABA website. Here's the URL: http://aba.org/birding/v42n1p54.pdf Here's a snippet from Ted's article: ------------------------------ Birding, as a recreation, is growing virally, and therefore all we can predict is that it will continue to grow, and to displace that which came before. Many National Audubon Society chapters, the ABA, local bird clubs, print magazines, North American Birds, and print field guides are relics that will either evolve in the digital world or disappear. Already, online resources such as eBird, All About Birds, BNA Online, and hundreds of birding blogs are taking their place. ------------------------------ I'd be interested in hearing folks' responses to Ted's article. Ted Floyd Editor, Birding Check out Birding magazine on Twitter: http://twitter.com/BirdingMagazine _________________________________________________________________ Your E-mail and More On-the-Go. Get Windows Live Hotmail Free. http://clk.atdmt.com/GBL/go/196390709/direct/01/ BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: Advice on Paup From: John Penhallurick <jpenhall AT BIGPOND.NET.AU> Date: Wed, 20 Jan 2010 11:50:07 +1100 Dear Friends,
I am puzzled why in using PAUP that it rejects the use of the first
semi-colon in the following bit of program.
TATTCGCCTATGCCATCCTASGCTCHATCCCTAMCAAATTAGGAGGAGTATWAGCCCTAG
CCGCCTCCGTACTTATCCTACTCCTAATCCCCCTTCTCCACAAATCCAAMYAACGCACAA
TAACTTTCCGCMCACTCTCTCAACTCCTCTTCTGAMCCATAMCCACCAACCTGCTAATCC
TCACRTGAGTAGGTAGCCAACCWGTAGMACACCCATTCATCATCATSGGCMAACTGGYTT
CCCTCACMTACTTTACAACAATTCTCATCCTATTCCCCACAATCAGTACTCTAGAAAACA
AATTACTTAACTACTAA
;
end;
BEGIN PAUP;
log file= modelfit.log replace;
DSet distance=JC objective=ME base=equal rates=equal pinv=0
subst=all negbrlen=setzero;
NJ showtree=no breakties=random;
End;
Many of the examples provided with PAUP use the semi-colon in this way. I
have done a careful count of the number of sequences and that's correct.
Can anyone help with this problem?
Thanks,
Dr John Penhallurick
86 Bingley Cres
Fraser A.C.T. 2615
Australia
email:jpenhall AT bigpond.net.au
Phone: Home (612) 62585428
Mobile:0408585426
Please visit my website:http://www.worldbirdinfo.net
BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html
Archives: http://listserv.arizona.edu/archives/birdchat.html
Subject: Re: Trip Report: ChiapasFrom: Alaxsxaq <alaxsxaq AT GMAIL.COM> Date: Tue, 19 Jan 2010 18:32:22 -0500 On Tue, Jan 19, 2010 at 4:41 PM, Janet DuerrSubject: Trip Report: Chiapas From: Janet Duerr <duerr AT OHIO.EDU> Date: Tue, 19 Jan 2010 16:41:20 -0500 This report reviews the logistics and special birds of our (relatively)
recent (Dec 5–13, 2009) trip to Villahermosa, Palenque, and San
Cristóbal de las Casas, Mexico. We relied on information from Howell's
bird finding guide, as well as trip reports and tips from BirdChat and
Mexico Birds folks. We had limited time birding on most days, since we were
traveling with my non-birding parents.
[Dec 5: Late evening arrival in Villahermosa]
Dec 6: From Villahermosa (including a visit to La Venta Archaeological Park
— highly recommended), we drove to Frontera and the Centla Biosphere
reserve (about 1 hr).
http://www.ecoturismolatino.com/eng/ecotravellers/guide/countries/mexico/destinations/npa/ecentla.htm
We drove fairly slowly along the road that parallels the Grijalva River to
where it becomes the Usumacinta River, scanning the small, isolated trees
and grassy areas. Along the way, we spotted one immature and one adult
BLACK-COLLARED HAWK, perched low over the watery margins of the marshes. We
picked up our pace as the day waned; we spotted one PINNATED BITTERN
stalking through a field just before dusk. (If you plan to take this route,
start early in the day. We left Villahermosa at 1:00 pm and ran out of
daylight considerably before we ran out of marsh. We ended up driving the
last hour and a half from Jonuta to the main Highway 186 in pitch darkness,
getting lost multiple times on the way. Thank goodness for cell phone
reception and Google Maps, or we might still be out there.) We spent the
next three nights at the Chan-kah Resort outside of Palenque.
Dec 7–9: Palenque and surrounds — mornings birding, afternoons
sightseeing.
Chan-kah: We spent one morning on the hotel grounds (very birdy).
Highlights included WHITE-BELLIED EMERALD, Long-tailed and Stripe-throated
Hermits, and Wedge-tailed Sabrewings at the flowers. We located a pair of
roosting Vermiculated Screech-Owls by following a large flock of agitated
songbirds. The owls were clearly unfazed by human presence: They were
calmly roosting in shrubs a few feet above the ground and less than five
feet off one of the paths between cabins — a nice photo-op!
Road to Palenque: The main gates along the entrance road to the park were
already open each morning when we arrived (as early as 6:00 am), so we were
able to drive up the hill to the turnout and trailhead at the big curve
just before the entrance to the archaeological site. At 6:00, it was still
too dark to see in the woods, so we birded along the roadside until 6:20 or
6:30. We hiked the two trails starting near the cascade trail sign. The
main trail that begins at the sign crosses the stream (boots and a walking
stick required) and continues on the other side through relatively intact
secondary woods. The second trail is slightly downhill of the main trail
and is only briefly in the woods before skirting along the edge of a field.
We emerged by about 8:00 am to go down to the entrance gate and purchase
day passes. We occasionally saw a guard at the trailhead; the guards didn't
show much interest in what we were doing.
The trails were wooded enough to have multiple viewable MEXICAN ANTTHRUSH,
but were otherwise rather quiet. Other highlights included [Northern]
Violaceous Trogon, Blue-crowned Motmot, Smoky-brown and Chestnut-colored
Woodpecker, Tawny-winged and Streak-headed Woodcreeper, Orange-billed
Sparrow, Blue-black Grosbeak, Red-crowned and Red-throated Ant-Tanager,
Scrub and Olive-backed Euphonia, as well as numerous North American
migrants.
The archaeological ruins open at 8:00 am. As noted in previous trip
reports, the trail behind the Temple of the Inscriptions was closed.
However, we found a SCALED ANTPITTA near the trail by the Cross group. The
relatively open underbrush there and the fearless nature of this
human-acclimatized bird allowed stunning views. There was also one fruiting
tree on the grounds, which provided some afternoon birding entertainment
when most activity had quieted down.
Dec 9: We left at 10:00 am and headed towards San Cristóbal de las Casas.
We made brief stops to view the very different (and both beautiful)
waterfalls at Misol-ha and Agua Azul. As noted in previous reports, two
small payments, one for using the road and one for viewing the falls, are
required for each stop. Upon arrival in Ocosingo at about 3:00 pm, we had a
quick late lunch and then continued on to San Cristóbal, arriving around
5:30 pm. The road was as full of topes as advertised, a very slow but
scenic drive. We stayed at Bela's B&B, a very nice place where my parents
could hang out in comfort and relative quiet, yet were within a couple of
blocks of the sights.
Dec 10–11: San Cristóbal — mornings birding, afternoons sightseeing,
two nights owling.
Ocosingo Highway: We spent two mornings at the "trails" arising from the
Ocosingo Highway, 2 km from the junction with the Pan-American Highway.
This is the site described in Howell; while others have had unpleasant
encounters here, we only encountered one hunter (no quail here!) who was
friendly and acquainted with the idea of birders. The "lower" or left
branch of the trail goes through mixed oak and pine and seemed birdier than
the higher, all-pine trails. Our first morning we quickly had Pink-headed
and Golden-browed Warblers (mixed with North American migrants) and
Amethyst-throated, Garnet-throated and White-eared Hummingbirds. We
occasionally heard calling jays, but pursued them without much luck. The
second morning, we used a tape and called in Steller's, Unicolored, and
BLACK-THROATED JAYS. The three species were in mixed groups of varying
proportions, containing roughly two to ten individuals each. They were
generally indiscriminate in their response to the tapes; each species of
live bird seemed to respond more or less well to each species of recorded
bird. The Unicolored Jays were the only ones to spend any time on the outer
branches of the pines and were therefore relatively easy to see; with the
other two species it was mostly glimpses here and there.
Huitepec Reserve: We went here late one morning to hike the loop trail (not
as birdy as Ocosingo) and to arrange for owling with Javier. We went owling
with Javier two nights, once from 8:00–10:30 pm and the next night from
5:00–9:00 pm. Javier was a great guide—he knew just where the Unspotted
Saw-whet and Bearded Screech-Owls hung out. (Note: Javier doesn't have any
playback equipment or spotlights, so be sure to bring your own. He speaks a
little bit of English; combined with our meager Spanish, we communicated
well enough.) The first night we called in at least two Bearded
Screech-Owls to very close range, but despite their vociferous calling, we
could not spot them. Later, an owl whooshed past my husband's head as soon
as he started playing the Unspotted Saw-whet Owl call, but we neither saw
nor heard this species. On the second night, the weather was not conducive
to owling; it was windy and colder, and we heard not a hoot. So now we have
a good excuse to return to Chiapas.
[Dec 12: Drive from San Cristóbal to Villahermosa (via Tuxtla Gutiérrez:
beautiful scenery, and generally better roads that the Palenque/Ocosingo
route).]
[Dec 13: Early return flight]
Thanks to all the Chatters for their help and suggestions.
Janet Duerr
Athens, Ohio, USA
BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html
Archives: http://listserv.arizona.edu/archives/birdchat.html
Subject: Clements 2009 taxonomy update availableFrom: Jerry Blinn <support AT AVISYS.NET> Date: Mon, 18 Jan 2010 15:19:11 -0700 The Clements 2009 Taxonomy Update for AviSys users, and the AviSys 6.00K program update, are now available at www.avisys.net Thanks for your patience, Jerry Jerry Blinn Perceptive Systems Placitas, NM 505-867-6255 jerry AT avisys.net Web Site: www.avisys.net BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.htmlSubject: British Columbia: Oriental Turtle-Dove From: Rick Wright <birdaz AT GMAIL.COM> Date: Mon, 18 Jan 2010 15:18:56 -0700 An Oriental Turtle Dove was photographed an hour ago at British Columbia's Alaksen NWA. I haven't seen the images. This will be about the third record for Canada if accepted. -- Rick Wright Vancouver and Tucson http://birdaz.com, http://birdaz.com/blog BirdChat Guidelines: http://www.ksu.edu/audubon/chatguidelines.html Archives: http://listserv.arizona.edu/archives/birdchat.html |